ID: 1173177000

View in Genome Browser
Species Human (GRCh38)
Location 20:40771980-40772002
Sequence CCTCAGGAAATGAGGCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173176989_1173177000 28 Left 1173176989 20:40771929-40771951 CCGGGAATCTGGCAGCCACTCTC No data
Right 1173177000 20:40771980-40772002 CCTCAGGAAATGAGGCCTCATGG No data
1173176996_1173177000 2 Left 1173176996 20:40771955-40771977 CCAGAGATGGAACTGGGAGGCAT No data
Right 1173177000 20:40771980-40772002 CCTCAGGAAATGAGGCCTCATGG No data
1173176988_1173177000 29 Left 1173176988 20:40771928-40771950 CCCGGGAATCTGGCAGCCACTCT No data
Right 1173177000 20:40771980-40772002 CCTCAGGAAATGAGGCCTCATGG No data
1173176992_1173177000 13 Left 1173176992 20:40771944-40771966 CCACTCTCTGGCCAGAGATGGAA No data
Right 1173177000 20:40771980-40772002 CCTCAGGAAATGAGGCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173177000 Original CRISPR CCTCAGGAAATGAGGCCTCA TGG Intergenic
No off target data available for this crispr