ID: 1173177838

View in Genome Browser
Species Human (GRCh38)
Location 20:40777860-40777882
Sequence GGTCCCAGGAAGCACCAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173177833_1173177838 3 Left 1173177833 20:40777834-40777856 CCAGGGCAAGTAGTATATTTAGG No data
Right 1173177838 20:40777860-40777882 GGTCCCAGGAAGCACCAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173177838 Original CRISPR GGTCCCAGGAAGCACCAGTA GGG Intergenic
No off target data available for this crispr