ID: 1173178883

View in Genome Browser
Species Human (GRCh38)
Location 20:40786614-40786636
Sequence ATGCAGAAGAGGCAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173178883_1173178895 25 Left 1173178883 20:40786614-40786636 CCATCCTGCTGCCTCTTCTGCAT No data
Right 1173178895 20:40786662-40786684 CACCTCTCTCACTTGTCTTCGGG No data
1173178883_1173178887 -2 Left 1173178883 20:40786614-40786636 CCATCCTGCTGCCTCTTCTGCAT No data
Right 1173178887 20:40786635-40786657 ATGGACTGCCCTTCCTTCCCTGG No data
1173178883_1173178894 24 Left 1173178883 20:40786614-40786636 CCATCCTGCTGCCTCTTCTGCAT No data
Right 1173178894 20:40786661-40786683 CCACCTCTCTCACTTGTCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173178883 Original CRISPR ATGCAGAAGAGGCAGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr