ID: 1173180681

View in Genome Browser
Species Human (GRCh38)
Location 20:40804283-40804305
Sequence GCATGGGAACAGCTTCCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173180681_1173180689 13 Left 1173180681 20:40804283-40804305 CCCGGGGGAAGCTGTTCCCATGC No data
Right 1173180689 20:40804319-40804341 TTCTTGCCATGTAGGGCTCCTGG No data
1173180681_1173180687 6 Left 1173180681 20:40804283-40804305 CCCGGGGGAAGCTGTTCCCATGC No data
Right 1173180687 20:40804312-40804334 GACACCATTCTTGCCATGTAGGG No data
1173180681_1173180686 5 Left 1173180681 20:40804283-40804305 CCCGGGGGAAGCTGTTCCCATGC No data
Right 1173180686 20:40804311-40804333 AGACACCATTCTTGCCATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173180681 Original CRISPR GCATGGGAACAGCTTCCCCC GGG (reversed) Intergenic
No off target data available for this crispr