ID: 1173182863

View in Genome Browser
Species Human (GRCh38)
Location 20:40817784-40817806
Sequence AAGCTCATCCATAGGCCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173182860_1173182863 8 Left 1173182860 20:40817753-40817775 CCTGAGCTGTGGCTACTTGGTTA No data
Right 1173182863 20:40817784-40817806 AAGCTCATCCATAGGCCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173182863 Original CRISPR AAGCTCATCCATAGGCCAGT TGG Intergenic
No off target data available for this crispr