ID: 1173182910

View in Genome Browser
Species Human (GRCh38)
Location 20:40818093-40818115
Sequence CAGGCACAAGATCCCATGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173182908_1173182910 -7 Left 1173182908 20:40818077-40818099 CCTCTGGCTGGGACCACAGGCAC No data
Right 1173182910 20:40818093-40818115 CAGGCACAAGATCCCATGCTAGG No data
1173182906_1173182910 3 Left 1173182906 20:40818067-40818089 CCTAGGGTCACCTCTGGCTGGGA No data
Right 1173182910 20:40818093-40818115 CAGGCACAAGATCCCATGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173182910 Original CRISPR CAGGCACAAGATCCCATGCT AGG Intergenic
No off target data available for this crispr