ID: 1173185241

View in Genome Browser
Species Human (GRCh38)
Location 20:40835535-40835557
Sequence CACCACTAAGCACACACGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173185241_1173185243 16 Left 1173185241 20:40835535-40835557 CCAGACGTGTGTGCTTAGTGGTG No data
Right 1173185243 20:40835574-40835596 ACATTCCGACCCTGTGTCAGAGG No data
1173185241_1173185248 28 Left 1173185241 20:40835535-40835557 CCAGACGTGTGTGCTTAGTGGTG No data
Right 1173185248 20:40835586-40835608 TGTGTCAGAGGCAGATGCATGGG No data
1173185241_1173185247 27 Left 1173185241 20:40835535-40835557 CCAGACGTGTGTGCTTAGTGGTG No data
Right 1173185247 20:40835585-40835607 CTGTGTCAGAGGCAGATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173185241 Original CRISPR CACCACTAAGCACACACGTC TGG (reversed) Intergenic
No off target data available for this crispr