ID: 1173185242

View in Genome Browser
Species Human (GRCh38)
Location 20:40835569-40835591
Sequence GACACAGGGTCGGAATGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173185242_1173185250 15 Left 1173185242 20:40835569-40835591 CCTGCACATTCCGACCCTGTGTC No data
Right 1173185250 20:40835607-40835629 GGACAGCAGCGTGGAAGTTCTGG No data
1173185242_1173185247 -7 Left 1173185242 20:40835569-40835591 CCTGCACATTCCGACCCTGTGTC No data
Right 1173185247 20:40835585-40835607 CTGTGTCAGAGGCAGATGCATGG No data
1173185242_1173185251 16 Left 1173185242 20:40835569-40835591 CCTGCACATTCCGACCCTGTGTC No data
Right 1173185251 20:40835608-40835630 GACAGCAGCGTGGAAGTTCTGGG No data
1173185242_1173185249 6 Left 1173185242 20:40835569-40835591 CCTGCACATTCCGACCCTGTGTC No data
Right 1173185249 20:40835598-40835620 AGATGCATGGGACAGCAGCGTGG No data
1173185242_1173185248 -6 Left 1173185242 20:40835569-40835591 CCTGCACATTCCGACCCTGTGTC No data
Right 1173185248 20:40835586-40835608 TGTGTCAGAGGCAGATGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173185242 Original CRISPR GACACAGGGTCGGAATGTGC AGG (reversed) Intergenic
No off target data available for this crispr