ID: 1173185247

View in Genome Browser
Species Human (GRCh38)
Location 20:40835585-40835607
Sequence CTGTGTCAGAGGCAGATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173185242_1173185247 -7 Left 1173185242 20:40835569-40835591 CCTGCACATTCCGACCCTGTGTC No data
Right 1173185247 20:40835585-40835607 CTGTGTCAGAGGCAGATGCATGG No data
1173185241_1173185247 27 Left 1173185241 20:40835535-40835557 CCAGACGTGTGTGCTTAGTGGTG No data
Right 1173185247 20:40835585-40835607 CTGTGTCAGAGGCAGATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173185247 Original CRISPR CTGTGTCAGAGGCAGATGCA TGG Intergenic
No off target data available for this crispr