ID: 1173185247 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:40835585-40835607 |
Sequence | CTGTGTCAGAGGCAGATGCA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1173185242_1173185247 | -7 | Left | 1173185242 | 20:40835569-40835591 | CCTGCACATTCCGACCCTGTGTC | No data | ||
Right | 1173185247 | 20:40835585-40835607 | CTGTGTCAGAGGCAGATGCATGG | No data | ||||
1173185241_1173185247 | 27 | Left | 1173185241 | 20:40835535-40835557 | CCAGACGTGTGTGCTTAGTGGTG | No data | ||
Right | 1173185247 | 20:40835585-40835607 | CTGTGTCAGAGGCAGATGCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1173185247 | Original CRISPR | CTGTGTCAGAGGCAGATGCA TGG | Intergenic | ||
No off target data available for this crispr |