ID: 1173186278

View in Genome Browser
Species Human (GRCh38)
Location 20:40842932-40842954
Sequence CCCACTAGGTGGTAAGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173186278_1173186282 29 Left 1173186278 20:40842932-40842954 CCTGGAACTTACCACCTAGTGGG No data
Right 1173186282 20:40842984-40843006 ACTGAGAGCATTACAGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173186278 Original CRISPR CCCACTAGGTGGTAAGTTCC AGG (reversed) Intergenic
No off target data available for this crispr