ID: 1173188208

View in Genome Browser
Species Human (GRCh38)
Location 20:40857283-40857305
Sequence CAGGAAGCTTACAATTATGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173188208_1173188210 -5 Left 1173188208 20:40857283-40857305 CCGTCATAATTGTAAGCTTCCTG No data
Right 1173188210 20:40857301-40857323 TCCTGAGGCCTCCCCAGCCATGG 0: 66
1: 115
2: 152
3: 210
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173188208 Original CRISPR CAGGAAGCTTACAATTATGA CGG (reversed) Intergenic
No off target data available for this crispr