ID: 1173188588

View in Genome Browser
Species Human (GRCh38)
Location 20:40859659-40859681
Sequence CAGGCAGAGAACGGGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173188581_1173188588 -3 Left 1173188581 20:40859639-40859661 CCATCTTGGCTGCTTCCAGCCAG No data
Right 1173188588 20:40859659-40859681 CAGGCAGAGAACGGGGCTGCTGG No data
1173188580_1173188588 -2 Left 1173188580 20:40859638-40859660 CCCATCTTGGCTGCTTCCAGCCA No data
Right 1173188588 20:40859659-40859681 CAGGCAGAGAACGGGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173188588 Original CRISPR CAGGCAGAGAACGGGGCTGC TGG Intergenic
No off target data available for this crispr