ID: 1173190205

View in Genome Browser
Species Human (GRCh38)
Location 20:40870144-40870166
Sequence GTGGGTTCACAGGTTGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173190205_1173190216 30 Left 1173190205 20:40870144-40870166 CCTGCATCAACCTGTGAACCCAC No data
Right 1173190216 20:40870197-40870219 AGAACTGCAGCTCTGGACATGGG No data
1173190205_1173190213 23 Left 1173190205 20:40870144-40870166 CCTGCATCAACCTGTGAACCCAC No data
Right 1173190213 20:40870190-40870212 GCCAAGCAGAACTGCAGCTCTGG No data
1173190205_1173190215 29 Left 1173190205 20:40870144-40870166 CCTGCATCAACCTGTGAACCCAC No data
Right 1173190215 20:40870196-40870218 CAGAACTGCAGCTCTGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173190205 Original CRISPR GTGGGTTCACAGGTTGATGC AGG (reversed) Intergenic
No off target data available for this crispr