ID: 1173193409 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:40894239-40894261 |
Sequence | CCTGAGAGGCAGGTATGGCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1173193401_1173193409 | 27 | Left | 1173193401 | 20:40894189-40894211 | CCTCTAAAAAACAGCTTCCAGAC | No data | ||
Right | 1173193409 | 20:40894239-40894261 | CCTGAGAGGCAGGTATGGCAGGG | No data | ||||
1173193402_1173193409 | 10 | Left | 1173193402 | 20:40894206-40894228 | CCAGACATTATTTTATTATAATT | No data | ||
Right | 1173193409 | 20:40894239-40894261 | CCTGAGAGGCAGGTATGGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1173193409 | Original CRISPR | CCTGAGAGGCAGGTATGGCA GGG | Intergenic | ||
No off target data available for this crispr |