ID: 1173193409

View in Genome Browser
Species Human (GRCh38)
Location 20:40894239-40894261
Sequence CCTGAGAGGCAGGTATGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173193401_1173193409 27 Left 1173193401 20:40894189-40894211 CCTCTAAAAAACAGCTTCCAGAC No data
Right 1173193409 20:40894239-40894261 CCTGAGAGGCAGGTATGGCAGGG No data
1173193402_1173193409 10 Left 1173193402 20:40894206-40894228 CCAGACATTATTTTATTATAATT No data
Right 1173193409 20:40894239-40894261 CCTGAGAGGCAGGTATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173193409 Original CRISPR CCTGAGAGGCAGGTATGGCA GGG Intergenic
No off target data available for this crispr