ID: 1173193758

View in Genome Browser
Species Human (GRCh38)
Location 20:40896772-40896794
Sequence GGCACACACCATAGTGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173193758_1173193767 12 Left 1173193758 20:40896772-40896794 CCCTGCACACTATGGTGTGTGCC No data
Right 1173193767 20:40896807-40896829 TACTTGGGATGCTAAGGTGGCGG No data
1173193758_1173193768 13 Left 1173193758 20:40896772-40896794 CCCTGCACACTATGGTGTGTGCC No data
Right 1173193768 20:40896808-40896830 ACTTGGGATGCTAAGGTGGCGGG No data
1173193758_1173193764 6 Left 1173193758 20:40896772-40896794 CCCTGCACACTATGGTGTGTGCC No data
Right 1173193764 20:40896801-40896823 CCCAACTACTTGGGATGCTAAGG 0: 4
1: 193
2: 7376
3: 111419
4: 223806
1173193758_1173193766 9 Left 1173193758 20:40896772-40896794 CCCTGCACACTATGGTGTGTGCC No data
Right 1173193766 20:40896804-40896826 AACTACTTGGGATGCTAAGGTGG No data
1173193758_1173193760 -4 Left 1173193758 20:40896772-40896794 CCCTGCACACTATGGTGTGTGCC No data
Right 1173193760 20:40896791-40896813 TGCCTGTAATCCCAACTACTTGG 0: 1438
1: 56348
2: 105818
3: 164666
4: 247953
1173193758_1173193761 -3 Left 1173193758 20:40896772-40896794 CCCTGCACACTATGGTGTGTGCC No data
Right 1173193761 20:40896792-40896814 GCCTGTAATCCCAACTACTTGGG 0: 1011
1: 40832
2: 167876
3: 281841
4: 464048
1173193758_1173193769 29 Left 1173193758 20:40896772-40896794 CCCTGCACACTATGGTGTGTGCC No data
Right 1173193769 20:40896824-40896846 TGGCGGGATCACTTGAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173193758 Original CRISPR GGCACACACCATAGTGTGCA GGG (reversed) Intergenic
No off target data available for this crispr