ID: 1173193760

View in Genome Browser
Species Human (GRCh38)
Location 20:40896791-40896813
Sequence TGCCTGTAATCCCAACTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 576223
Summary {0: 1438, 1: 56348, 2: 105818, 3: 164666, 4: 247953}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173193759_1173193760 -5 Left 1173193759 20:40896773-40896795 CCTGCACACTATGGTGTGTGCCT No data
Right 1173193760 20:40896791-40896813 TGCCTGTAATCCCAACTACTTGG 0: 1438
1: 56348
2: 105818
3: 164666
4: 247953
1173193758_1173193760 -4 Left 1173193758 20:40896772-40896794 CCCTGCACACTATGGTGTGTGCC No data
Right 1173193760 20:40896791-40896813 TGCCTGTAATCCCAACTACTTGG 0: 1438
1: 56348
2: 105818
3: 164666
4: 247953

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173193760 Original CRISPR TGCCTGTAATCCCAACTACT TGG Intergenic
Too many off-targets to display for this crispr