ID: 1173193761

View in Genome Browser
Species Human (GRCh38)
Location 20:40896792-40896814
Sequence GCCTGTAATCCCAACTACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 955608
Summary {0: 1011, 1: 40832, 2: 167876, 3: 281841, 4: 464048}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173193759_1173193761 -4 Left 1173193759 20:40896773-40896795 CCTGCACACTATGGTGTGTGCCT No data
Right 1173193761 20:40896792-40896814 GCCTGTAATCCCAACTACTTGGG 0: 1011
1: 40832
2: 167876
3: 281841
4: 464048
1173193758_1173193761 -3 Left 1173193758 20:40896772-40896794 CCCTGCACACTATGGTGTGTGCC No data
Right 1173193761 20:40896792-40896814 GCCTGTAATCCCAACTACTTGGG 0: 1011
1: 40832
2: 167876
3: 281841
4: 464048

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173193761 Original CRISPR GCCTGTAATCCCAACTACTT GGG Intergenic
Too many off-targets to display for this crispr