ID: 1173193762

View in Genome Browser
Species Human (GRCh38)
Location 20:40896793-40896815
Sequence TCCCAAGTAGTTGGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173193762_1173193772 27 Left 1173193762 20:40896793-40896815 CCTGTAATCCCAACTACTTGGGA No data
Right 1173193772 20:40896843-40896865 CAGGTGTTCAAGTCCAGCCTAGG No data
1173193762_1173193768 -8 Left 1173193762 20:40896793-40896815 CCTGTAATCCCAACTACTTGGGA No data
Right 1173193768 20:40896808-40896830 ACTTGGGATGCTAAGGTGGCGGG No data
1173193762_1173193769 8 Left 1173193762 20:40896793-40896815 CCTGTAATCCCAACTACTTGGGA No data
Right 1173193769 20:40896824-40896846 TGGCGGGATCACTTGAGCCCAGG No data
1173193762_1173193767 -9 Left 1173193762 20:40896793-40896815 CCTGTAATCCCAACTACTTGGGA No data
Right 1173193767 20:40896807-40896829 TACTTGGGATGCTAAGGTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173193762 Original CRISPR TCCCAAGTAGTTGGGATTAC AGG (reversed) Intergenic