ID: 1173193763

View in Genome Browser
Species Human (GRCh38)
Location 20:40896801-40896823
Sequence CCTTAGCATCCCAAGTAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173193763_1173193769 0 Left 1173193763 20:40896801-40896823 CCCAACTACTTGGGATGCTAAGG No data
Right 1173193769 20:40896824-40896846 TGGCGGGATCACTTGAGCCCAGG No data
1173193763_1173193772 19 Left 1173193763 20:40896801-40896823 CCCAACTACTTGGGATGCTAAGG No data
Right 1173193772 20:40896843-40896865 CAGGTGTTCAAGTCCAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173193763 Original CRISPR CCTTAGCATCCCAAGTAGTT GGG (reversed) Intergenic