ID: 1173193764

View in Genome Browser
Species Human (GRCh38)
Location 20:40896801-40896823
Sequence CCCAACTACTTGGGATGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173193759_1173193764 5 Left 1173193759 20:40896773-40896795 CCTGCACACTATGGTGTGTGCCT No data
Right 1173193764 20:40896801-40896823 CCCAACTACTTGGGATGCTAAGG No data
1173193758_1173193764 6 Left 1173193758 20:40896772-40896794 CCCTGCACACTATGGTGTGTGCC No data
Right 1173193764 20:40896801-40896823 CCCAACTACTTGGGATGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173193764 Original CRISPR CCCAACTACTTGGGATGCTA AGG Intergenic