ID: 1173193765

View in Genome Browser
Species Human (GRCh38)
Location 20:40896802-40896824
Sequence ACCTTAGCATCCCAAGTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173193765_1173193769 -1 Left 1173193765 20:40896802-40896824 CCAACTACTTGGGATGCTAAGGT No data
Right 1173193769 20:40896824-40896846 TGGCGGGATCACTTGAGCCCAGG No data
1173193765_1173193772 18 Left 1173193765 20:40896802-40896824 CCAACTACTTGGGATGCTAAGGT No data
Right 1173193772 20:40896843-40896865 CAGGTGTTCAAGTCCAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173193765 Original CRISPR ACCTTAGCATCCCAAGTAGT TGG (reversed) Intergenic