ID: 1173193767

View in Genome Browser
Species Human (GRCh38)
Location 20:40896807-40896829
Sequence TACTTGGGATGCTAAGGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173193758_1173193767 12 Left 1173193758 20:40896772-40896794 CCCTGCACACTATGGTGTGTGCC No data
Right 1173193767 20:40896807-40896829 TACTTGGGATGCTAAGGTGGCGG No data
1173193759_1173193767 11 Left 1173193759 20:40896773-40896795 CCTGCACACTATGGTGTGTGCCT No data
Right 1173193767 20:40896807-40896829 TACTTGGGATGCTAAGGTGGCGG No data
1173193762_1173193767 -9 Left 1173193762 20:40896793-40896815 CCTGTAATCCCAACTACTTGGGA 0: 1442
1: 53549
2: 149678
3: 271960
4: 545591
Right 1173193767 20:40896807-40896829 TACTTGGGATGCTAAGGTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173193767 Original CRISPR TACTTGGGATGCTAAGGTGG CGG Intergenic
No off target data available for this crispr