ID: 1173193768

View in Genome Browser
Species Human (GRCh38)
Location 20:40896808-40896830
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173193762_1173193768 -8 Left 1173193762 20:40896793-40896815 CCTGTAATCCCAACTACTTGGGA No data
Right 1173193768 20:40896808-40896830 ACTTGGGATGCTAAGGTGGCGGG No data
1173193758_1173193768 13 Left 1173193758 20:40896772-40896794 CCCTGCACACTATGGTGTGTGCC No data
Right 1173193768 20:40896808-40896830 ACTTGGGATGCTAAGGTGGCGGG No data
1173193759_1173193768 12 Left 1173193759 20:40896773-40896795 CCTGCACACTATGGTGTGTGCCT No data
Right 1173193768 20:40896808-40896830 ACTTGGGATGCTAAGGTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173193768 Original CRISPR ACTTGGGATGCTAAGGTGGC GGG Intergenic