ID: 1173193769

View in Genome Browser
Species Human (GRCh38)
Location 20:40896824-40896846
Sequence TGGCGGGATCACTTGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173193763_1173193769 0 Left 1173193763 20:40896801-40896823 CCCAACTACTTGGGATGCTAAGG 0: 4
1: 205
2: 7780
3: 116247
4: 227222
Right 1173193769 20:40896824-40896846 TGGCGGGATCACTTGAGCCCAGG No data
1173193759_1173193769 28 Left 1173193759 20:40896773-40896795 CCTGCACACTATGGTGTGTGCCT No data
Right 1173193769 20:40896824-40896846 TGGCGGGATCACTTGAGCCCAGG No data
1173193762_1173193769 8 Left 1173193762 20:40896793-40896815 CCTGTAATCCCAACTACTTGGGA 0: 1442
1: 53549
2: 149678
3: 271960
4: 545591
Right 1173193769 20:40896824-40896846 TGGCGGGATCACTTGAGCCCAGG No data
1173193758_1173193769 29 Left 1173193758 20:40896772-40896794 CCCTGCACACTATGGTGTGTGCC No data
Right 1173193769 20:40896824-40896846 TGGCGGGATCACTTGAGCCCAGG No data
1173193765_1173193769 -1 Left 1173193765 20:40896802-40896824 CCAACTACTTGGGATGCTAAGGT No data
Right 1173193769 20:40896824-40896846 TGGCGGGATCACTTGAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173193769 Original CRISPR TGGCGGGATCACTTGAGCCC AGG Intergenic
No off target data available for this crispr