ID: 1173195098

View in Genome Browser
Species Human (GRCh38)
Location 20:40907763-40907785
Sequence GCCACCTTCCGGATACTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173195098_1173195104 11 Left 1173195098 20:40907763-40907785 CCCCACAGTATCCGGAAGGTGGC No data
Right 1173195104 20:40907797-40907819 AAATCTCTTTCTGTCCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173195098 Original CRISPR GCCACCTTCCGGATACTGTG GGG (reversed) Intergenic
No off target data available for this crispr