ID: 1173195129 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:40907987-40908009 |
| Sequence | TTGGAGTGTAGGAGTTGAGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1173195129_1173195136 | 10 | Left | 1173195129 | 20:40907987-40908009 | CCTGCTCAACTCCTACACTCCAA | No data | ||
| Right | 1173195136 | 20:40908020-40908042 | GCTCAGGCATCACCTCCTCTGGG | No data | ||||
| 1173195129_1173195131 | -6 | Left | 1173195129 | 20:40907987-40908009 | CCTGCTCAACTCCTACACTCCAA | No data | ||
| Right | 1173195131 | 20:40908004-40908026 | CTCCAATCAAGACCCAGCTCAGG | No data | ||||
| 1173195129_1173195135 | 9 | Left | 1173195129 | 20:40907987-40908009 | CCTGCTCAACTCCTACACTCCAA | No data | ||
| Right | 1173195135 | 20:40908019-40908041 | AGCTCAGGCATCACCTCCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1173195129 | Original CRISPR | TTGGAGTGTAGGAGTTGAGC AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||