ID: 1173195129

View in Genome Browser
Species Human (GRCh38)
Location 20:40907987-40908009
Sequence TTGGAGTGTAGGAGTTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173195129_1173195136 10 Left 1173195129 20:40907987-40908009 CCTGCTCAACTCCTACACTCCAA No data
Right 1173195136 20:40908020-40908042 GCTCAGGCATCACCTCCTCTGGG No data
1173195129_1173195131 -6 Left 1173195129 20:40907987-40908009 CCTGCTCAACTCCTACACTCCAA No data
Right 1173195131 20:40908004-40908026 CTCCAATCAAGACCCAGCTCAGG No data
1173195129_1173195135 9 Left 1173195129 20:40907987-40908009 CCTGCTCAACTCCTACACTCCAA No data
Right 1173195135 20:40908019-40908041 AGCTCAGGCATCACCTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173195129 Original CRISPR TTGGAGTGTAGGAGTTGAGC AGG (reversed) Intergenic
No off target data available for this crispr