ID: 1173197540

View in Genome Browser
Species Human (GRCh38)
Location 20:40928255-40928277
Sequence CTGTGGGAGTGCAGAGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173197540_1173197548 3 Left 1173197540 20:40928255-40928277 CCCTCTCCTCTGCACTCCCACAG No data
Right 1173197548 20:40928281-40928303 CCTAGACAGGCCTTCATAACTGG No data
1173197540_1173197549 8 Left 1173197540 20:40928255-40928277 CCCTCTCCTCTGCACTCCCACAG No data
Right 1173197549 20:40928286-40928308 ACAGGCCTTCATAACTGGCGTGG No data
1173197540_1173197551 15 Left 1173197540 20:40928255-40928277 CCCTCTCCTCTGCACTCCCACAG No data
Right 1173197551 20:40928293-40928315 TTCATAACTGGCGTGGCACCTGG No data
1173197540_1173197543 -10 Left 1173197540 20:40928255-40928277 CCCTCTCCTCTGCACTCCCACAG No data
Right 1173197543 20:40928268-40928290 ACTCCCACAGCACCCTAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173197540 Original CRISPR CTGTGGGAGTGCAGAGGAGA GGG (reversed) Intergenic
No off target data available for this crispr