ID: 1173197543

View in Genome Browser
Species Human (GRCh38)
Location 20:40928268-40928290
Sequence ACTCCCACAGCACCCTAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173197536_1173197543 16 Left 1173197536 20:40928229-40928251 CCCTGACCTCACCAAAGAGAGTT No data
Right 1173197543 20:40928268-40928290 ACTCCCACAGCACCCTAGACAGG No data
1173197537_1173197543 15 Left 1173197537 20:40928230-40928252 CCTGACCTCACCAAAGAGAGTTA No data
Right 1173197543 20:40928268-40928290 ACTCCCACAGCACCCTAGACAGG No data
1173197538_1173197543 10 Left 1173197538 20:40928235-40928257 CCTCACCAAAGAGAGTTAATCCC No data
Right 1173197543 20:40928268-40928290 ACTCCCACAGCACCCTAGACAGG No data
1173197535_1173197543 20 Left 1173197535 20:40928225-40928247 CCTTCCCTGACCTCACCAAAGAG No data
Right 1173197543 20:40928268-40928290 ACTCCCACAGCACCCTAGACAGG No data
1173197540_1173197543 -10 Left 1173197540 20:40928255-40928277 CCCTCTCCTCTGCACTCCCACAG No data
Right 1173197543 20:40928268-40928290 ACTCCCACAGCACCCTAGACAGG No data
1173197539_1173197543 5 Left 1173197539 20:40928240-40928262 CCAAAGAGAGTTAATCCCTCTCC No data
Right 1173197543 20:40928268-40928290 ACTCCCACAGCACCCTAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173197543 Original CRISPR ACTCCCACAGCACCCTAGAC AGG Intergenic
No off target data available for this crispr