ID: 1173197548

View in Genome Browser
Species Human (GRCh38)
Location 20:40928281-40928303
Sequence CCTAGACAGGCCTTCATAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173197541_1173197548 2 Left 1173197541 20:40928256-40928278 CCTCTCCTCTGCACTCCCACAGC No data
Right 1173197548 20:40928281-40928303 CCTAGACAGGCCTTCATAACTGG No data
1173197538_1173197548 23 Left 1173197538 20:40928235-40928257 CCTCACCAAAGAGAGTTAATCCC No data
Right 1173197548 20:40928281-40928303 CCTAGACAGGCCTTCATAACTGG No data
1173197536_1173197548 29 Left 1173197536 20:40928229-40928251 CCCTGACCTCACCAAAGAGAGTT No data
Right 1173197548 20:40928281-40928303 CCTAGACAGGCCTTCATAACTGG No data
1173197542_1173197548 -3 Left 1173197542 20:40928261-40928283 CCTCTGCACTCCCACAGCACCCT No data
Right 1173197548 20:40928281-40928303 CCTAGACAGGCCTTCATAACTGG No data
1173197539_1173197548 18 Left 1173197539 20:40928240-40928262 CCAAAGAGAGTTAATCCCTCTCC No data
Right 1173197548 20:40928281-40928303 CCTAGACAGGCCTTCATAACTGG No data
1173197537_1173197548 28 Left 1173197537 20:40928230-40928252 CCTGACCTCACCAAAGAGAGTTA No data
Right 1173197548 20:40928281-40928303 CCTAGACAGGCCTTCATAACTGG No data
1173197540_1173197548 3 Left 1173197540 20:40928255-40928277 CCCTCTCCTCTGCACTCCCACAG No data
Right 1173197548 20:40928281-40928303 CCTAGACAGGCCTTCATAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173197548 Original CRISPR CCTAGACAGGCCTTCATAAC TGG Intergenic
No off target data available for this crispr