ID: 1173197551

View in Genome Browser
Species Human (GRCh38)
Location 20:40928293-40928315
Sequence TTCATAACTGGCGTGGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173197546_1173197551 -10 Left 1173197546 20:40928280-40928302 CCCTAGACAGGCCTTCATAACTG No data
Right 1173197551 20:40928293-40928315 TTCATAACTGGCGTGGCACCTGG No data
1173197545_1173197551 -2 Left 1173197545 20:40928272-40928294 CCACAGCACCCTAGACAGGCCTT No data
Right 1173197551 20:40928293-40928315 TTCATAACTGGCGTGGCACCTGG No data
1173197539_1173197551 30 Left 1173197539 20:40928240-40928262 CCAAAGAGAGTTAATCCCTCTCC No data
Right 1173197551 20:40928293-40928315 TTCATAACTGGCGTGGCACCTGG No data
1173197544_1173197551 -1 Left 1173197544 20:40928271-40928293 CCCACAGCACCCTAGACAGGCCT No data
Right 1173197551 20:40928293-40928315 TTCATAACTGGCGTGGCACCTGG No data
1173197540_1173197551 15 Left 1173197540 20:40928255-40928277 CCCTCTCCTCTGCACTCCCACAG No data
Right 1173197551 20:40928293-40928315 TTCATAACTGGCGTGGCACCTGG No data
1173197542_1173197551 9 Left 1173197542 20:40928261-40928283 CCTCTGCACTCCCACAGCACCCT No data
Right 1173197551 20:40928293-40928315 TTCATAACTGGCGTGGCACCTGG No data
1173197541_1173197551 14 Left 1173197541 20:40928256-40928278 CCTCTCCTCTGCACTCCCACAGC No data
Right 1173197551 20:40928293-40928315 TTCATAACTGGCGTGGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173197551 Original CRISPR TTCATAACTGGCGTGGCACC TGG Intergenic
No off target data available for this crispr