ID: 1173207842

View in Genome Browser
Species Human (GRCh38)
Location 20:41008415-41008437
Sequence CAGGACGTCCAAGGCTTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173207842_1173207848 8 Left 1173207842 20:41008415-41008437 CCCCTGAAGCCTTGGACGTCCTG No data
Right 1173207848 20:41008446-41008468 ACAGTTCCTCTTTCACTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173207842 Original CRISPR CAGGACGTCCAAGGCTTCAG GGG (reversed) Intergenic
No off target data available for this crispr