ID: 1173207843

View in Genome Browser
Species Human (GRCh38)
Location 20:41008416-41008438
Sequence CCAGGACGTCCAAGGCTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173207843_1173207848 7 Left 1173207843 20:41008416-41008438 CCCTGAAGCCTTGGACGTCCTGG No data
Right 1173207848 20:41008446-41008468 ACAGTTCCTCTTTCACTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173207843 Original CRISPR CCAGGACGTCCAAGGCTTCA GGG (reversed) Intergenic
No off target data available for this crispr