ID: 1173207845

View in Genome Browser
Species Human (GRCh38)
Location 20:41008417-41008439
Sequence TCCAGGACGTCCAAGGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173207845_1173207848 6 Left 1173207845 20:41008417-41008439 CCTGAAGCCTTGGACGTCCTGGA No data
Right 1173207848 20:41008446-41008468 ACAGTTCCTCTTTCACTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173207845 Original CRISPR TCCAGGACGTCCAAGGCTTC AGG (reversed) Intergenic
No off target data available for this crispr