ID: 1173207848

View in Genome Browser
Species Human (GRCh38)
Location 20:41008446-41008468
Sequence ACAGTTCCTCTTTCACTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173207840_1173207848 15 Left 1173207840 20:41008408-41008430 CCCTCTGCCCCTGAAGCCTTGGA No data
Right 1173207848 20:41008446-41008468 ACAGTTCCTCTTTCACTTCAAGG No data
1173207846_1173207848 -1 Left 1173207846 20:41008424-41008446 CCTTGGACGTCCTGGAATACATA No data
Right 1173207848 20:41008446-41008468 ACAGTTCCTCTTTCACTTCAAGG No data
1173207843_1173207848 7 Left 1173207843 20:41008416-41008438 CCCTGAAGCCTTGGACGTCCTGG No data
Right 1173207848 20:41008446-41008468 ACAGTTCCTCTTTCACTTCAAGG No data
1173207842_1173207848 8 Left 1173207842 20:41008415-41008437 CCCCTGAAGCCTTGGACGTCCTG No data
Right 1173207848 20:41008446-41008468 ACAGTTCCTCTTTCACTTCAAGG No data
1173207845_1173207848 6 Left 1173207845 20:41008417-41008439 CCTGAAGCCTTGGACGTCCTGGA No data
Right 1173207848 20:41008446-41008468 ACAGTTCCTCTTTCACTTCAAGG No data
1173207841_1173207848 14 Left 1173207841 20:41008409-41008431 CCTCTGCCCCTGAAGCCTTGGAC No data
Right 1173207848 20:41008446-41008468 ACAGTTCCTCTTTCACTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173207848 Original CRISPR ACAGTTCCTCTTTCACTTCA AGG Intergenic
No off target data available for this crispr