ID: 1173218503

View in Genome Browser
Species Human (GRCh38)
Location 20:41111141-41111163
Sequence GTCCATGTGCACTAGAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173218500_1173218503 6 Left 1173218500 20:41111112-41111134 CCTAGGGGACTTTGAGACAGGCT 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1173218503 20:41111141-41111163 GTCCATGTGCACTAGAGTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 92
1173218499_1173218503 7 Left 1173218499 20:41111111-41111133 CCCTAGGGGACTTTGAGACAGGC 0: 1
1: 0
2: 1
3: 8
4: 116
Right 1173218503 20:41111141-41111163 GTCCATGTGCACTAGAGTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173218503 Original CRISPR GTCCATGTGCACTAGAGTGA GGG Intronic
903036356 1:20495248-20495270 GCCCAAGTGCACAAGAGGGATGG - Intergenic
905201483 1:36319829-36319851 GGCCTTGTCCCCTAGAGTGAGGG - Exonic
913092476 1:115487527-115487549 GTCCATGGGCTCCATAGTGATGG - Intergenic
917625453 1:176841470-176841492 GTCCAAGTACACTAAAGAGATGG - Intronic
917890875 1:179437220-179437242 GTCCTTGTCCACTAGAGGCAAGG - Intronic
918155265 1:181839101-181839123 ATCCATATGCAAAAGAGTGAAGG + Intergenic
921810639 1:219509097-219509119 GTCTATGTTCATGAGAGTGAGGG - Intergenic
1063916496 10:10888129-10888151 GTACATGTGCACAAGATTTATGG + Intergenic
1065204876 10:23347701-23347723 GTCCTTGAGCACTGGAGTAAAGG + Intergenic
1067364292 10:45610743-45610765 GTACATGTGCAGCAGAGTGAGGG - Intergenic
1071388871 10:85149830-85149852 TACCATGTGCACTAGAGAAATGG + Intergenic
1077481535 11:2817072-2817094 GGGCATGTGGACTAGGGTGAGGG - Intronic
1081244247 11:40745071-40745093 TTCCATGTGCAATATGGTGATGG - Intronic
1082238365 11:49847611-49847633 GTCTATGTGGCATAGAGTGAAGG - Intergenic
1085630612 11:78113062-78113084 ATCCATGTCTACTAGGGTGAAGG + Intronic
1086756921 11:90576540-90576562 ATACATGTGCACTAGAGAGAAGG + Intergenic
1087992135 11:104758192-104758214 GACCATGTGTGCTAGAGTGCTGG - Intergenic
1090683174 11:129083980-129084002 GTCCATGTGATCTGTAGTGACGG - Intronic
1099011443 12:77296041-77296063 GTTCATGTGCAGTAGAGAAAAGG + Intergenic
1102472698 12:113168475-113168497 GTCCATCTGTGCTAGAGGGAGGG - Intronic
1109243375 13:59920790-59920812 TTCCATGTGCAGTTGAGAGAAGG - Intronic
1111131946 13:83988111-83988133 GTCCTTCTGTACAAGAGTGAGGG - Intergenic
1114807903 14:25858946-25858968 ATACATGTGTACTTGAGTGAAGG - Intergenic
1114895653 14:26987795-26987817 GGCCATGTGCACAAGCCTGATGG + Intergenic
1115898421 14:38117582-38117604 GCCCATGTGCACTGGAGGAATGG + Intergenic
1116217290 14:42033914-42033936 ATACATGTACACTAGAGTGAAGG - Intergenic
1117720950 14:58628209-58628231 TACCATGTCCACTAGGGTGAGGG - Intergenic
1122420297 14:101572176-101572198 CTCCACGTGCACTGCAGTGAGGG + Intergenic
1122420345 14:101572488-101572510 CTCCATGTGCACAGCAGTGAGGG + Intergenic
1122420368 14:101572644-101572666 CTCCATGTGCACAGCAGTGAGGG + Intergenic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1129183091 15:73889150-73889172 GGCCAGGGGCACTGGAGTGAGGG + Exonic
1134776135 16:16855285-16855307 TTCAATGTGTACCAGAGTGATGG + Intergenic
1138402585 16:56759282-56759304 CTGCATTTGCATTAGAGTGAAGG + Intronic
1140946880 16:79776923-79776945 CCCCATGTGCACTAAAGGGAAGG - Intergenic
1143828700 17:9633569-9633591 TTCTATGTGGACTAGAGTTAAGG + Intronic
1144614319 17:16754737-16754759 GTCCATGTGGTCTATAGTGCAGG + Intronic
1144898388 17:18560940-18560962 GTCCATGTGGTCTATAGTGCAGG - Intergenic
1145133987 17:20384781-20384803 GTCCATGTGGTCTATAGTGCAGG + Intergenic
1146563228 17:33889730-33889752 TTGCATCTGCACTGGAGTGAGGG - Intronic
1148895735 17:50838030-50838052 GTCCTTGGGCACCAGAGGGAAGG - Intronic
1149783389 17:59415881-59415903 GTGGATGTGCACTAGGTTGAGGG + Intergenic
1154049966 18:10944940-10944962 GTCCATGTGCAGTGCAGGGAGGG + Intronic
1155419539 18:25640059-25640081 GTCCATGAGCACTGGAGAGTGGG - Intergenic
1155950431 18:31905379-31905401 GTCCATATGCACCAAAGTGTAGG - Intronic
1162326601 19:10003280-10003302 GTCCTGGGGCACTAGAGGGAGGG - Intronic
1167423714 19:49418583-49418605 GTCCATGTGAATAAGAGGGAGGG - Intergenic
928818367 2:35326405-35326427 GTCCATGTGCACTTGAGAAATGG - Intergenic
932946343 2:76236583-76236605 GTCCATTTGGTCTAGAGTGCAGG + Intergenic
946093967 2:217256092-217256114 GTCCTTGAGCACTTCAGTGAAGG + Intergenic
1169580061 20:7011567-7011589 GTCCATGTGCTCTAGAAAGAAGG - Intergenic
1170458082 20:16552121-16552143 GTCCATGTGCAGGAGAGACAAGG - Intronic
1172576261 20:36011045-36011067 CTCCATGTGCAGAAGAGTGAGGG + Intronic
1173218503 20:41111141-41111163 GTCCATGTGCACTAGAGTGAGGG + Intronic
1173665548 20:44760425-44760447 ATCCAGGTGCACTGGAGAGAAGG + Intronic
1178384472 21:32138130-32138152 GTCCATGGGCACAAGACCGAGGG - Intergenic
1179544860 21:42107192-42107214 GTGCATTTGTTCTAGAGTGAGGG + Intronic
1181328929 22:22074310-22074332 GTCTCTGTGCTTTAGAGTGAGGG - Intergenic
1182662051 22:31932102-31932124 GTCCATGTGGAAGAGAGTGGAGG + Intergenic
950427792 3:12934002-12934024 GCCCATGTGCCCTAGAGGGGAGG - Intronic
950623319 3:14225367-14225389 GTCCTTGTCCACTAGAGGCAAGG + Intergenic
966343852 3:178956497-178956519 GTCTATGACCTCTAGAGTGAGGG - Intergenic
967365059 3:188676973-188676995 GTCCATGTGGTAAAGAGTGAGGG + Intronic
969846528 4:9924258-9924280 GTCCATGTGCAGGAGAGACATGG - Intronic
973346367 4:49060250-49060272 GTCCATGGGCACTGGAGTCAGGG + Intronic
974570850 4:63646991-63647013 GTCTATGTACATTAGAGTGTTGG + Intergenic
981593072 4:146386852-146386874 GTCCATGGGCACTTGAGGAAAGG + Intronic
981738292 4:147975605-147975627 GTGCATGTGCAAGTGAGTGAGGG + Intronic
983258287 4:165427023-165427045 CTGCATGTGCACTAGTATGATGG - Intronic
984325981 4:178251237-178251259 GGCCATGTAGACTTGAGTGATGG - Intergenic
985848550 5:2371883-2371905 ATCCAAGTGGACGAGAGTGAAGG - Intergenic
987953569 5:24707524-24707546 GTCCATGTGTTTAAGAGTGACGG + Intergenic
995171165 5:109114147-109114169 GTCCTTTTACATTAGAGTGAGGG - Intronic
997090291 5:130848789-130848811 GCCCAGGTGCACCAGAGTCATGG - Intergenic
1002527581 5:179823518-179823540 GTCCATGTTCACTCTAGGGATGG + Intronic
1007664177 6:43504965-43504987 GTGCATGTGGACATGAGTGAGGG + Exonic
1011075070 6:83430676-83430698 GTCCGTATCCACTAGAGTGATGG - Intronic
1011172761 6:84524305-84524327 GTGCATGTGCACGTGTGTGATGG + Intergenic
1013761724 6:113526587-113526609 GTGAATGTGCACTAGAGTTGAGG - Intergenic
1014827198 6:126060067-126060089 GTTCATGTTCACTAGAATGCTGG - Intergenic
1016023470 6:139259899-139259921 GTCAAAGAGCACTAGACTGATGG - Intronic
1017229431 6:152056648-152056670 GTCCATTTGCACTTAAGTAATGG - Intronic
1022516834 7:30980313-30980335 GTGCATGTTCACTAGAGTGCAGG - Intronic
1022992705 7:35724596-35724618 GTCCATGGGCACAAGCCTGAGGG - Intergenic
1023345162 7:39264324-39264346 GTCCAAGTGCATTTGAATGACGG - Intronic
1027247817 7:76379309-76379331 AGACTTGTGCACTAGAGTGAGGG - Intergenic
1027607001 7:80313131-80313153 GCCCTTGTGCACTAGAGGCAAGG - Intergenic
1032858307 7:135855148-135855170 TTCCATGCAAACTAGAGTGAAGG + Intergenic
1033074179 7:138233178-138233200 GTCCTTGTCCACTAGAGGCAAGG - Intergenic
1033711224 7:143948432-143948454 GTCCTTGTGCGATAGAGTTAAGG + Intergenic
1036225672 8:6955595-6955617 GTCTATGTCCACTAGTCTGAAGG + Intergenic
1041934353 8:63319841-63319863 GTAACTGTGCACTAGAGTAAGGG + Intergenic
1051948653 9:22603355-22603377 GGCCATATTCACAAGAGTGATGG + Intergenic
1056377399 9:86028128-86028150 GTCCATGGGCACAAGCCTGAGGG - Intronic
1059748365 9:117224940-117224962 CTCAATGGGCACTAGGGTGATGG - Intronic
1059907180 9:119000692-119000714 TTCCATGTACTCTAGAGTGAAGG - Intergenic
1186006531 X:5078289-5078311 GCCCATAAGCACTAAAGTGAAGG - Intergenic
1187483831 X:19683397-19683419 GTGGTTCTGCACTAGAGTGAAGG - Intronic
1187504709 X:19869509-19869531 GACCATGTCCACAAGAGAGAAGG + Intronic
1188729607 X:33630721-33630743 GTCCATGTGTGCTAGAATGCTGG - Intergenic
1188978020 X:36699396-36699418 GTCCCTTAGCACTACAGTGATGG - Intergenic
1196289815 X:113926732-113926754 GTCCATTTGCTCTATAGTGAAGG + Intergenic
1196517906 X:116634822-116634844 ATCCATATGCAGAAGAGTGAAGG + Intergenic
1199615210 X:149650406-149650428 ATGCATGTGCACATGAGTGAAGG - Intergenic
1200297564 X:154937411-154937433 GTACATGTGCACTAGGGGGAGGG + Intronic