ID: 1173221503

View in Genome Browser
Species Human (GRCh38)
Location 20:41136560-41136582
Sequence GCAAATGCTCTCCTGAACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173221503_1173221513 22 Left 1173221503 20:41136560-41136582 CCAAAGTTCAGGAGAGCATTTGC No data
Right 1173221513 20:41136605-41136627 TCTGAGTCGGAGCCCCGAATCGG No data
1173221503_1173221509 -6 Left 1173221503 20:41136560-41136582 CCAAAGTTCAGGAGAGCATTTGC No data
Right 1173221509 20:41136577-41136599 ATTTGCAGGAGGGCGCTGCGGGG No data
1173221503_1173221511 -1 Left 1173221503 20:41136560-41136582 CCAAAGTTCAGGAGAGCATTTGC No data
Right 1173221511 20:41136582-41136604 CAGGAGGGCGCTGCGGGGTAGGG No data
1173221503_1173221510 -2 Left 1173221503 20:41136560-41136582 CCAAAGTTCAGGAGAGCATTTGC No data
Right 1173221510 20:41136581-41136603 GCAGGAGGGCGCTGCGGGGTAGG No data
1173221503_1173221507 -8 Left 1173221503 20:41136560-41136582 CCAAAGTTCAGGAGAGCATTTGC No data
Right 1173221507 20:41136575-41136597 GCATTTGCAGGAGGGCGCTGCGG No data
1173221503_1173221508 -7 Left 1173221503 20:41136560-41136582 CCAAAGTTCAGGAGAGCATTTGC No data
Right 1173221508 20:41136576-41136598 CATTTGCAGGAGGGCGCTGCGGG No data
1173221503_1173221512 9 Left 1173221503 20:41136560-41136582 CCAAAGTTCAGGAGAGCATTTGC No data
Right 1173221512 20:41136592-41136614 CTGCGGGGTAGGGTCTGAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173221503 Original CRISPR GCAAATGCTCTCCTGAACTT TGG (reversed) Intergenic
No off target data available for this crispr