ID: 1173221507

View in Genome Browser
Species Human (GRCh38)
Location 20:41136575-41136597
Sequence GCATTTGCAGGAGGGCGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173221503_1173221507 -8 Left 1173221503 20:41136560-41136582 CCAAAGTTCAGGAGAGCATTTGC No data
Right 1173221507 20:41136575-41136597 GCATTTGCAGGAGGGCGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173221507 Original CRISPR GCATTTGCAGGAGGGCGCTG CGG Intergenic
No off target data available for this crispr