ID: 1173225469

View in Genome Browser
Species Human (GRCh38)
Location 20:41160051-41160073
Sequence CTCCATCTACAGTCAGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 226}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173225469_1173225473 -4 Left 1173225469 20:41160051-41160073 CCCAGGCCTGACTGTAGATGGAG 0: 1
1: 0
2: 0
3: 16
4: 226
Right 1173225473 20:41160070-41160092 GGAGAAGTGGCCCTCACCTCAGG 0: 1
1: 0
2: 0
3: 19
4: 200
1173225469_1173225476 10 Left 1173225469 20:41160051-41160073 CCCAGGCCTGACTGTAGATGGAG 0: 1
1: 0
2: 0
3: 16
4: 226
Right 1173225476 20:41160084-41160106 CACCTCAGGCTTCTCTCTCCAGG 0: 1
1: 0
2: 2
3: 36
4: 352
1173225469_1173225479 19 Left 1173225469 20:41160051-41160073 CCCAGGCCTGACTGTAGATGGAG 0: 1
1: 0
2: 0
3: 16
4: 226
Right 1173225479 20:41160093-41160115 CTTCTCTCTCCAGGTGGCTCCGG 0: 1
1: 0
2: 6
3: 36
4: 361
1173225469_1173225478 13 Left 1173225469 20:41160051-41160073 CCCAGGCCTGACTGTAGATGGAG 0: 1
1: 0
2: 0
3: 16
4: 226
Right 1173225478 20:41160087-41160109 CTCAGGCTTCTCTCTCCAGGTGG 0: 1
1: 1
2: 1
3: 33
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173225469 Original CRISPR CTCCATCTACAGTCAGGCCT GGG (reversed) Intronic
901190796 1:7408680-7408702 TGCCATCTACAGTAAGCCCTGGG + Intronic
902400079 1:16152785-16152807 CTACTTCTAGAGCCAGGCCTAGG - Intronic
905598511 1:39230055-39230077 GGACATCTACAGCCAGGCCTTGG - Intronic
908354669 1:63318283-63318305 CGCCATTTACAGGCACGCCTTGG + Intergenic
909643028 1:77888317-77888339 CTCCACCTCCAGCCAGGCCTGGG - Intergenic
910645022 1:89505257-89505279 CTCCATCTTGAGTAAGGGCTAGG + Intergenic
911728910 1:101271317-101271339 CGCCATCAACAGCCAGTCCTTGG - Intergenic
912116006 1:106408994-106409016 CTCCATCTTCAGAAAGACCTTGG - Intergenic
913480153 1:119280355-119280377 CTCCATCCACTGGCAGGCTTGGG - Intergenic
913574881 1:120162153-120162175 CCCCTTATACATTCAGGCCTAGG + Intronic
914296146 1:146326995-146327017 CCCCTTATACATTCAGGCCTAGG + Intergenic
914557188 1:148777785-148777807 CCCCTTATACATTCAGGCCTAGG + Intergenic
914615646 1:149352445-149352467 CCCCTTATACATTCAGGCCTAGG - Intergenic
917646787 1:177036732-177036754 GTCCTTCTACAGTGAGGACTTGG + Intronic
918738126 1:188092985-188093007 CTCCATCTTGAGTGAGGGCTAGG + Intergenic
920962300 1:210674276-210674298 CTCCCTCTGCAGGCTGGCCTTGG + Exonic
921680528 1:218026003-218026025 CTCCATCTTGAGTGAGGGCTAGG + Intergenic
921790986 1:219290300-219290322 CTCCATCTTGAGTGAGGGCTAGG + Intergenic
924139905 1:241011561-241011583 CTCCATCTTGAGTAAGGGCTAGG + Intronic
924301259 1:242640436-242640458 CTCCATCTTCGGTGAGCCCTGGG + Intergenic
924655468 1:245971284-245971306 CCCCACCTCCAGACAGGCCTTGG - Intronic
1063237138 10:4128750-4128772 CTCCATCTTGAGTGAGGACTAGG + Intergenic
1064416586 10:15155269-15155291 CGCCATCAACAGCGAGGCCTTGG - Intronic
1064569920 10:16682235-16682257 CTCCATCTTGAGTGAGGGCTAGG + Intronic
1066434343 10:35383192-35383214 ATCCATTTACAGTCACCCCTAGG - Intronic
1069349574 10:67509345-67509367 CTCCACCCACCGACAGGCCTCGG + Intronic
1069809283 10:71146500-71146522 CTCCATAGACAGTCTGGCCCTGG + Intergenic
1069884813 10:71616926-71616948 ATCCATCTGCTGTCAGTCCTAGG + Intronic
1070919526 10:80175426-80175448 CTCCATCCACAGCCAGGCCAGGG + Intronic
1072747876 10:97954272-97954294 CACCATCTACATCCAGTCCTGGG - Intronic
1073533123 10:104251622-104251644 CTCCATCTTGAGTGAGGGCTAGG + Intronic
1074981692 10:118625044-118625066 CTCCATCTTGAGTGAGGGCTAGG + Intergenic
1076653461 10:132005653-132005675 CTCCATCTTGAGTGAGGGCTGGG + Intergenic
1076749702 10:132536779-132536801 CTCCATCTACAGGCATGTCCCGG + Intergenic
1077164829 11:1130331-1130353 CTCCATCCCAAGACAGGCCTGGG + Intergenic
1079153744 11:17924958-17924980 AACCATCTACAAACAGGCCTGGG + Intronic
1081351901 11:42064374-42064396 CTCCATCTTGAGTGAGGACTAGG + Intergenic
1083623156 11:64058870-64058892 TTCCATCTTCACTCTGGCCTGGG + Intronic
1084418145 11:69045946-69045968 CTCCATCTTGAGTGAGGACTAGG - Intergenic
1084418152 11:69045995-69046017 CTCCATCTTGAGTGAGGACTAGG - Intergenic
1084418158 11:69046044-69046066 CTCCATCTTGAGTGAGGACTAGG - Intergenic
1084418164 11:69046093-69046115 CTCCATCTTGAGTTAGGACTAGG - Intergenic
1084600190 11:70140939-70140961 CTCCATCTTGAGTGAGGACTAGG - Intronic
1087114078 11:94504903-94504925 TTCCATTTACAGTCAGGCTTGGG + Intergenic
1091870375 12:3884981-3885003 CTCCATCTACATTCAGGATTTGG + Intergenic
1092210546 12:6643566-6643588 CTCCATGTACTTCCAGGCCTTGG + Exonic
1092917504 12:13202026-13202048 CTCCCTCAACACACAGGCCTGGG - Intronic
1094527688 12:31243338-31243360 CTCCATCTGGGCTCAGGCCTGGG - Intergenic
1097439621 12:59593530-59593552 CTCCATCTTGAGTAAGGCCTGGG - Intergenic
1097553354 12:61104399-61104421 CTTCAGCTGCAGGCAGGCCTTGG - Intergenic
1098955622 12:76686857-76686879 CTCCATCTTGAGTGAGGGCTAGG - Intergenic
1100150718 12:91734192-91734214 TTCCATCTCCTGACAGGCCTGGG - Intergenic
1105304493 13:19159249-19159271 CACCCTCCACAGTCAGGCCAGGG + Intergenic
1105483629 13:20803820-20803842 CTCCATCTTGAGTGAGGGCTAGG + Intronic
1105937541 13:25116190-25116212 CTCCATCTTCAGTGAGGGCTAGG + Intergenic
1106033417 13:26022862-26022884 CTCAATCCAGAGTCAGGCCCTGG - Exonic
1107660123 13:42630583-42630605 CCGCATCTGCAGTCTGGCCTAGG - Intergenic
1108560429 13:51638014-51638036 CTCCATCTGGAGTGAGGGCTAGG - Intronic
1110504612 13:76271209-76271231 CTCCATCCCCAGACAGGCCCTGG + Intergenic
1112373884 13:98820876-98820898 CTCCATCTTGAGTGAGGGCTAGG - Intronic
1112452910 13:99527946-99527968 ATCAATCTAGAGTCAGACCTGGG - Intronic
1113524423 13:110963681-110963703 CTCCATCTTGAGTAAGGGCTTGG + Intergenic
1114963690 14:27928724-27928746 CTCCATCTTGAGTGAGGGCTAGG + Intergenic
1117035420 14:51723048-51723070 CTGCAGCTACAGGCAGGTCTGGG - Intronic
1117294207 14:54364352-54364374 CTCCATATACAGTCATCCCTTGG + Intergenic
1119691862 14:76679308-76679330 CTCCATCTTGAGTGAGGGCTAGG + Intergenic
1122391184 14:101386251-101386273 CTCCACCCACAAACAGGCCTCGG + Intergenic
1123040115 14:105487004-105487026 CTCCGTCCTCAGTCAGGCCCGGG + Intergenic
1125106548 15:35978546-35978568 CTCCATCTTGAGTGAGGGCTAGG + Intergenic
1125353174 15:38789012-38789034 CTCCACCTCCTGACAGGCCTCGG + Intergenic
1128119708 15:65136452-65136474 CTCCATCTTGAGTGAGGGCTAGG + Intergenic
1128342213 15:66830455-66830477 TTCCCTCCACAGTCAGGCCGTGG - Intergenic
1128429006 15:67573184-67573206 CTCCATCTTGAGTGAGGGCTAGG - Intronic
1129324911 15:74794751-74794773 CTGGCTCTATAGTCAGGCCTGGG - Intronic
1133278659 16:4652777-4652799 CACCATCTACTGCCAGGCATCGG + Exonic
1133943336 16:10328506-10328528 CTCCATCTTGAGTGAGGGCTAGG + Intronic
1134866586 16:17612575-17612597 CTCCATCTTGAGTGAGGGCTAGG - Intergenic
1135610543 16:23862770-23862792 CTCCATCTTGAGTAAGGGCTAGG + Intronic
1135946494 16:26869499-26869521 CTCCATCTTGAGTGAGGGCTAGG - Intergenic
1136417911 16:30114560-30114582 CTCCAGCTTCAGGCAGGCCAAGG - Exonic
1137512502 16:49114044-49114066 CACCAGCTTCAGTCAAGCCTCGG - Intergenic
1137675256 16:50300908-50300930 CTCCATCCACAGCCAGCCCCAGG - Intronic
1137874504 16:51983144-51983166 CTGCAGCTACAGCCATGCCTTGG + Intergenic
1138334843 16:56244894-56244916 CACCTTCTCCAGTCATGCCTGGG + Intronic
1141054576 16:80803876-80803898 CTCCATCTACTTTGCGGCCTTGG - Intronic
1146501832 17:33371307-33371329 CTCCATCTTGAGTGAGGGCTAGG - Intronic
1147995242 17:44356508-44356530 CTCCACCTACAGCCAGCTCTGGG - Exonic
1148152287 17:45404000-45404022 GCCCATCTACACTCAGGCCGGGG - Intronic
1148466199 17:47866643-47866665 CTCCATCTCCCATCAGGCCGCGG - Intergenic
1150214706 17:63460287-63460309 CTCCATCTTGAGTGAGGGCTAGG + Intergenic
1152269608 17:79316332-79316354 CCCCATCTACATGCTGGCCTGGG - Intronic
1152856433 17:82667326-82667348 CCACATCTTCAGGCAGGCCTGGG + Intronic
1155369122 18:25079337-25079359 CTCCATCCACGCTCAGGCCATGG + Intronic
1156964059 18:43068911-43068933 CTCCATCTTGAGTGAGGGCTAGG + Intronic
1157937903 18:51893483-51893505 CTCCATCTTGAGTAGGGCCTTGG - Intergenic
1159388332 18:67756470-67756492 CTCCATCTTGAGTGAGGGCTAGG + Intergenic
1162310984 19:9907075-9907097 CTCCATCTCCAGTCAACACTTGG + Intronic
1162904981 19:13817990-13818012 CTTCAGCAACAGCCAGGCCTAGG - Intronic
1165914775 19:39251333-39251355 CTCCATCTTGAGTGAGGGCTAGG - Intergenic
1166459242 19:42971634-42971656 CTCCATCTTGAGTGAGGGCTAGG + Intronic
1166476188 19:43126903-43126925 CTCCATCTTGAGTGAGGGCTAGG + Intronic
1166498068 19:43319510-43319532 CTCCATCTTGAGTGAGGGCTGGG - Intergenic
1168253346 19:55153945-55153967 CACCATCTGCCCTCAGGCCTAGG + Intronic
1168354062 19:55691409-55691431 CTCCATCCTCAGTCAGGGCCGGG + Intronic
1168387683 19:55979415-55979437 CTCCATCTGCTGCCAGGCCATGG + Exonic
925359504 2:3267683-3267705 CTACATCAAGACTCAGGCCTGGG + Intronic
926049706 2:9737022-9737044 CTCCAAATACAGTCAGTCCTGGG - Intergenic
926625257 2:15085402-15085424 CACTCCCTACAGTCAGGCCTGGG + Intergenic
928346646 2:30503870-30503892 CTCCCTCAAGACTCAGGCCTTGG + Intronic
928646251 2:33355806-33355828 ATCCCTCTGCAGTGAGGCCTAGG + Intronic
929533292 2:42765254-42765276 CTCCATATGCAGACAGGCCTGGG + Intergenic
930312671 2:49761293-49761315 CTTCATCCACCGTCAGTCCTAGG + Intergenic
930792506 2:55348879-55348901 CTGCATCTAAAGTCAGGTATGGG + Intronic
931872446 2:66476042-66476064 CTCCATCTGAAGTCAGGAATGGG + Intronic
932312049 2:70750775-70750797 CTCCATGTAAAGGCAGCCCTGGG + Intronic
932365736 2:71152066-71152088 CTCTATCTACAGTCAATCCTTGG + Intergenic
933776733 2:85775636-85775658 CTGCATCTACAGTCAGGGTAGGG + Intronic
936522018 2:113217529-113217551 CAGTATATACAGTCAGGCCTTGG + Exonic
937779205 2:125818409-125818431 CTCCATCAACAATCAGAACTAGG - Intergenic
939500759 2:142980459-142980481 CTCCATCTTGAGTAGGGCCTGGG - Intronic
944149019 2:196537605-196537627 CTCCATCTTGAGTGAGGGCTAGG + Intronic
947532809 2:230923570-230923592 CTCCAGCAACATTCAGGCATTGG - Intronic
948146431 2:235711592-235711614 GTCCATCCACACTCAGGCCAGGG - Intronic
1168808048 20:684455-684477 CTTCATGTATAGTCAGCCCTTGG + Intergenic
1170618915 20:17977833-17977855 CTCCATCTTGAGTGAGGGCTAGG - Intronic
1170723791 20:18907718-18907740 CTCCATCTTGAGTGAGGGCTAGG + Intergenic
1171028089 20:21651261-21651283 CTCCATCTTGAGTGAGGGCTAGG + Intergenic
1171028764 20:21656914-21656936 CTCCATCTTGAGTGAGGGCTAGG + Intergenic
1173076805 20:39827153-39827175 CTCCATCTTGAGTGAGGGCTAGG + Intergenic
1173225469 20:41160051-41160073 CTCCATCTACAGTCAGGCCTGGG - Intronic
1173225942 20:41162547-41162569 CCCCATCTACAGACAGCCCTGGG - Intronic
1173857146 20:46257791-46257813 CTCCATCAACAGTCACTCCCTGG - Intronic
1175076185 20:56376029-56376051 CTCCATCTAGATTGAAGCCTTGG + Intronic
1176000315 20:62828694-62828716 CTCCCTCTACAGTCCTGCCCTGG - Intronic
1179394759 21:41028600-41028622 CTCCATCTTGAGTAAGGGCTGGG - Intergenic
1181943163 22:26494710-26494732 TTGTACCTACAGTCAGGCCTTGG + Intronic
1182474671 22:30570201-30570223 CTCCAGCTACAGAAAGCCCTGGG - Intronic
1182825148 22:33258490-33258512 CTCCATCTTGAGTGAGGACTAGG + Intronic
1184250378 22:43256807-43256829 CTCCCTCCACTGTCCGGCCTGGG - Intronic
1184286518 22:43474899-43474921 CTGCATCTACCTTCAGGACTCGG + Exonic
1184585962 22:45448434-45448456 CTCCATCAACAGCCACTCCTGGG + Intergenic
1185027360 22:48423112-48423134 CTCCCTTCACAGTCAGCCCTGGG - Intergenic
1185079423 22:48701508-48701530 CCCCATCTACACAAAGGCCTGGG - Intronic
1185204693 22:49531114-49531136 CTCCATCCACAGGCAGGGGTGGG - Intronic
1185291877 22:50031360-50031382 CTCTAACCACAGTCAGGACTGGG + Intronic
950591542 3:13939452-13939474 CTCCATTTCGAGTGAGGCCTAGG - Intronic
952490356 3:33865316-33865338 CTCCATCTCCAGTGGGGGCTGGG + Exonic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
955628842 3:60950521-60950543 CTCCATCTCCACTCCAGCCTGGG - Intronic
956054082 3:65279954-65279976 ATCCATCTTCAGTGAGGGCTAGG - Intergenic
956069323 3:65431047-65431069 CTCCATCAACACTGGGGCCTAGG - Intronic
957951669 3:87135566-87135588 CTCCATCCACAGGCCAGCCTTGG + Intergenic
960224732 3:115156492-115156514 CTCCATCTTGAATCAGGGCTGGG - Intergenic
962047326 3:131774594-131774616 CTTCATGATCAGTCAGGCCTGGG - Intronic
962136580 3:132741298-132741320 CCCCACCCACAGACAGGCCTGGG + Intergenic
962343139 3:134601860-134601882 CTGGATCTTCAGTCAGGCCTGGG + Intronic
962470692 3:135705500-135705522 CTCCATATCCAGGCAGGTCTTGG + Intergenic
963360844 3:144270377-144270399 CTCTTTCTACAGTCTGGCTTAGG + Intergenic
966980064 3:185124253-185124275 CTTCATGTACAGTCATTCCTTGG - Intronic
967164642 3:186769713-186769735 CTCCATCTTGAGTGAGGGCTAGG - Intergenic
969612962 4:8237274-8237296 CCCCATCTACCGTGAGGCTTTGG - Intronic
972735543 4:41837546-41837568 CACCATCCAGAGTTAGGCCTGGG - Intergenic
978140662 4:105313912-105313934 GTCACTCTGCAGTCAGGCCTGGG + Intergenic
978978193 4:114907223-114907245 CTCCATCTACAGTGAATCCAAGG - Intronic
980875917 4:138661988-138662010 CTCCATCTTGAGTGAGGACTAGG - Intergenic
984097667 4:175451786-175451808 CTCCATCTTGAGTGAGGGCTAGG - Intergenic
984595207 4:181658944-181658966 CTCCATCTTGAGTGAGGGCTAGG + Intergenic
984652601 4:182286539-182286561 CTGCATCTACAGAAAGGGCTGGG - Intronic
985988824 5:3538672-3538694 CTCCCTCCAAAGACAGGCCTGGG - Intergenic
986631379 5:9776793-9776815 TTCCATCTACAGGCATTCCTTGG + Intergenic
987289333 5:16493646-16493668 CTCCAACTACAGTAAACCCTGGG - Intronic
988908492 5:35815263-35815285 CTCCATCTGCAGTCAAGCTCTGG + Intergenic
989742124 5:44785620-44785642 CTCCATCTTGAGTGAGGGCTAGG - Intergenic
989743078 5:44794575-44794597 CTCCATCTTGAGTGAGGGCTAGG - Intergenic
990714336 5:58620100-58620122 GTCTATAGACAGTCAGGCCTGGG + Intronic
990827582 5:59919345-59919367 CTCCAACTACAGTCATTCTTAGG + Intronic
991035813 5:62126384-62126406 CTGCACCTACAGTCTAGCCTGGG + Intergenic
992438867 5:76780852-76780874 CTCCATCTTCAGTAGGGGCTGGG + Intergenic
992877223 5:81068838-81068860 CTCTATCTAGACTGAGGCCTGGG - Intronic
994776946 5:104047484-104047506 CTCCCTCTACACTGTGGCCTCGG - Intergenic
995395064 5:111678610-111678632 TTCCTTCTACAGTCAGGTCTAGG + Intronic
998507435 5:142683306-142683328 CTCCATCTTGAGTGAGGGCTGGG + Intronic
998578912 5:143349516-143349538 CTCTATCCACACCCAGGCCTTGG + Intronic
999164189 5:149533921-149533943 CTCCATTTCCCGTCAGCCCTAGG - Intronic
999609712 5:153355432-153355454 CTTGATCTACAGTCAGGTCTAGG - Intergenic
1001552264 5:172611652-172611674 CTGCATCTACAGACAGACCTGGG - Intergenic
1001760671 5:174205572-174205594 CCCCATCTACAGGCAGTCCCCGG - Intronic
1002006631 5:176239118-176239140 CTCGCTCTGCAGTCAGGCCCTGG - Intronic
1002219747 5:177671518-177671540 CTCGCTCTGCAGTCAGGCCCTGG + Intergenic
1004268902 6:14176329-14176351 CTCCATCGACAGTCCTACCTTGG + Intergenic
1005218602 6:23560606-23560628 CTCCATCTTGAGTGAGGGCTAGG + Intergenic
1006626806 6:35403413-35403435 CACCGGCTTCAGTCAGGCCTGGG - Intronic
1006809582 6:36811175-36811197 CACCCTCTACAGTCAGACCCGGG - Intronic
1007186561 6:39976973-39976995 CTCCAGCTACACTCCAGCCTGGG - Intergenic
1007755398 6:44096078-44096100 CTCCCTCCACAGTTTGGCCTGGG + Intergenic
1011764440 6:90604914-90604936 TTCCACCCACAGTCAGGCTTGGG - Intergenic
1012039142 6:94182832-94182854 CTCCTTCTACTTTCAGGACTAGG - Intergenic
1015826367 6:137316866-137316888 CAACATCTCCAGTCAGGACTTGG + Intergenic
1019429771 7:993289-993311 CTCCAGTCACAGTCAGGCCCTGG - Intergenic
1020052202 7:5089099-5089121 CTCCTTCTGCCCTCAGGCCTGGG + Intergenic
1020543166 7:9488167-9488189 CTCCACCTTCAGGTAGGCCTCGG + Intergenic
1021180780 7:17503385-17503407 CTCATTCTACAGGCAGGCATTGG - Intergenic
1021588474 7:22235767-22235789 CTCCAACCACATTCAGCCCTGGG + Intronic
1021676088 7:23082112-23082134 CTCCATCTTGAGTGAGGGCTGGG - Intergenic
1022636937 7:32144834-32144856 CACCATCTGCAGTCATGGCTGGG + Intronic
1022716326 7:32901882-32901904 CTCCGGCTGCAGTCAAGCCTTGG + Intergenic
1023568360 7:41547540-41547562 CTCCATCTTGAGTGAGGGCTAGG - Intergenic
1026123801 7:67561792-67561814 CTCCATCTTGAGTGAGGGCTAGG + Intergenic
1026126165 7:67581660-67581682 CTCCATCTTGAGTGAGGGCTAGG - Intergenic
1026227348 7:68453939-68453961 CTCCATCTTGAGTGAGGGCTAGG + Intergenic
1027201260 7:76065223-76065245 CTCCATCTCCAGGCAGCCCAGGG + Intronic
1032148967 7:129411348-129411370 CTCCATCATCCGCCAGGCCTAGG + Intronic
1033335229 7:140446646-140446668 CTCCACCTTCAGTCAGACCAGGG - Intergenic
1033433697 7:141313039-141313061 CTCCATCTAGAATAGGGCCTGGG - Intronic
1034342460 7:150366831-150366853 CTCCCTCTACACTCCAGCCTGGG + Intergenic
1035908925 8:3544096-3544118 CTCCATCTTGAGTGAGGGCTTGG + Intronic
1035976328 8:4315465-4315487 CTTTATCTTGAGTCAGGCCTTGG - Intronic
1036672277 8:10799377-10799399 CCCCAGCAACTGTCAGGCCTCGG - Intronic
1038612960 8:29071128-29071150 CTCCATCTGGACCCAGGCCTGGG + Intronic
1039482162 8:37882229-37882251 CTCCATCTTGAGTGAGGGCTAGG + Intronic
1043820131 8:84853191-84853213 CTCCATCTTGAGTGAGGGCTAGG - Intronic
1044771673 8:95642232-95642254 CTAGATCTTCAGTCAGGGCTGGG - Intergenic
1047406078 8:124586772-124586794 CTCAATTCACATTCAGGCCTAGG + Intronic
1050896975 9:10895715-10895737 CTCCATCTTGAGTGAGGGCTAGG + Intergenic
1051532333 9:18118676-18118698 ATCCTTCTACACTCAGCCCTAGG + Intergenic
1055061820 9:72076747-72076769 CTCCATCATCAGCCAGGCATGGG + Intergenic
1056580135 9:87884244-87884266 CCCCATATCCAGGCAGGCCTTGG - Intronic
1057026910 9:91740929-91740951 ATCCATGTCCCGTCAGGCCTTGG - Intronic
1057435668 9:95038282-95038304 CTTCACCTACAGTCTGGGCTGGG - Intronic
1058634207 9:107020500-107020522 CTCCATTTATAGTGTGGCCTTGG + Intergenic
1059559921 9:115324264-115324286 CTCTAGCATCAGTCAGGCCTGGG + Intronic
1062133961 9:134914966-134914988 CTCCATCTGCAGTCACCCCCAGG - Intronic
1203749302 Un_GL000218v1:63625-63647 CTTCAGCTTCAGCCAGGCCTTGG + Intergenic
1186011736 X:5142222-5142244 CTCCATCTTGAGTGAGGGCTAGG - Intergenic
1186161649 X:6782996-6783018 CTCCATCTTGAGTGAGGGCTAGG + Intergenic
1186185822 X:7018768-7018790 CTCCATCTTGAGTGAGGGCTAGG + Intergenic
1187220952 X:17325279-17325301 CTCCATCTTGAGTGAGGGCTAGG - Intergenic
1187279435 X:17846680-17846702 CTCCCCCTGCAGCCAGGCCTAGG - Intronic
1193521056 X:82529004-82529026 ATACATCTCCAATCAGGCCTTGG - Intergenic
1199393600 X:147308984-147309006 CTCCATCTTGAGTGAGGGCTAGG + Intergenic
1199680437 X:150220769-150220791 ATCCATCTACAGACAGTGCTTGG + Intergenic
1199712098 X:150476911-150476933 CTCCCTCTAAAGTGGGGCCTTGG + Intronic
1200795848 Y:7340587-7340609 CTCCATCTTCAGGCAGGCCCAGG + Intergenic