ID: 1173225771

View in Genome Browser
Species Human (GRCh38)
Location 20:41161724-41161746
Sequence CCTCCTTGACACCACCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 2, 1: 0, 2: 3, 3: 21, 4: 258}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173225756_1173225771 21 Left 1173225756 20:41161680-41161702 CCAGGCTCTTGGGGCCCAGAGGA 0: 1
1: 0
2: 4
3: 36
4: 302
Right 1173225771 20:41161724-41161746 CCTCCTTGACACCACCTTCCAGG 0: 2
1: 0
2: 3
3: 21
4: 258
1173225754_1173225771 22 Left 1173225754 20:41161679-41161701 CCCAGGCTCTTGGGGCCCAGAGG 0: 1
1: 1
2: 1
3: 34
4: 355
Right 1173225771 20:41161724-41161746 CCTCCTTGACACCACCTTCCAGG 0: 2
1: 0
2: 3
3: 21
4: 258
1173225752_1173225771 28 Left 1173225752 20:41161673-41161695 CCTCCTCCCAGGCTCTTGGGGCC 0: 1
1: 0
2: 3
3: 51
4: 586
Right 1173225771 20:41161724-41161746 CCTCCTTGACACCACCTTCCAGG 0: 2
1: 0
2: 3
3: 21
4: 258
1173225762_1173225771 -9 Left 1173225762 20:41161710-41161732 CCACCCTCCCCTCCCCTCCTTGA 0: 1
1: 2
2: 30
3: 299
4: 2081
Right 1173225771 20:41161724-41161746 CCTCCTTGACACCACCTTCCAGG 0: 2
1: 0
2: 3
3: 21
4: 258
1173225761_1173225771 -8 Left 1173225761 20:41161709-41161731 CCCACCCTCCCCTCCCCTCCTTG 0: 1
1: 1
2: 91
3: 1057
4: 5772
Right 1173225771 20:41161724-41161746 CCTCCTTGACACCACCTTCCAGG 0: 2
1: 0
2: 3
3: 21
4: 258
1173225759_1173225771 7 Left 1173225759 20:41161694-41161716 CCCAGAGGAGGTGGTCCCACCCT 0: 1
1: 0
2: 0
3: 14
4: 151
Right 1173225771 20:41161724-41161746 CCTCCTTGACACCACCTTCCAGG 0: 2
1: 0
2: 3
3: 21
4: 258
1173225760_1173225771 6 Left 1173225760 20:41161695-41161717 CCAGAGGAGGTGGTCCCACCCTC 0: 1
1: 0
2: 0
3: 14
4: 147
Right 1173225771 20:41161724-41161746 CCTCCTTGACACCACCTTCCAGG 0: 2
1: 0
2: 3
3: 21
4: 258
1173225753_1173225771 25 Left 1173225753 20:41161676-41161698 CCTCCCAGGCTCTTGGGGCCCAG 0: 1
1: 0
2: 4
3: 45
4: 401
Right 1173225771 20:41161724-41161746 CCTCCTTGACACCACCTTCCAGG 0: 2
1: 0
2: 3
3: 21
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173225771 Original CRISPR CCTCCTTGACACCACCTTCC AGG Intronic
900911357 1:5599071-5599093 CCTACTTGAATCCACCTTCCTGG - Intergenic
900981309 1:6047758-6047780 CCTCCTGGACCCAACCTTCAGGG + Intronic
900981664 1:6049341-6049363 CCTCCTGGACTCAACCTTCAGGG + Intronic
903410763 1:23141199-23141221 CCTCCTTTCCCCCACCTTCCAGG - Intronic
903776064 1:25794620-25794642 CCTCCTTGACACCTCCGTGAGGG + Intergenic
906661503 1:47586028-47586050 CCTCCTTGTCCCCTCCTTCAGGG - Intergenic
906939881 1:50246475-50246497 CCTAGCTGACACCACCTTCACGG - Intergenic
907310383 1:53535629-53535651 CCACCTTGTAATCACCTTCCAGG + Intronic
908401380 1:63774916-63774938 CCTCCTGGACCGCGCCTTCCGGG - Intronic
908633251 1:66133815-66133837 CCTCCTACTCCCCACCTTCCAGG - Intronic
908703029 1:66922569-66922591 TCTCCTTGCCAACACCCTCCAGG - Intronic
908755349 1:67464595-67464617 GCTCCTTGACATGGCCTTCCAGG + Intergenic
913496655 1:119433798-119433820 GCTCCTTGCCCCCACCTTCTGGG + Intergenic
915513526 1:156400138-156400160 CCTCTTTGGCATCTCCTTCCAGG + Intergenic
917577784 1:176342208-176342230 TCTCATTGCCACAACCTTCCAGG - Intergenic
917790417 1:178495794-178495816 CTTCCTTGACTCCACCCTCTTGG + Intergenic
918160881 1:181898443-181898465 CATCCTTGAGACCTCCTTGCTGG + Intergenic
920675166 1:208033420-208033442 ACACCTTGACCCCACTTTCCAGG + Exonic
921302381 1:213763525-213763547 GGTCCTTGACTCTACCTTCCAGG + Intergenic
922997422 1:229975541-229975563 CCACCTTCACATCTCCTTCCTGG - Intergenic
923046745 1:230361486-230361508 CCCCCATCACACCACCTACCTGG + Intronic
923276326 1:232400075-232400097 CCTCCTCAATACCACCTGCCTGG + Intronic
924329766 1:242929762-242929784 CCTCCTTGACACAACCTATTTGG - Intergenic
1063365258 10:5486690-5486712 CCTCCTGGTCAGCACCTTCCTGG + Intergenic
1063878384 10:10505598-10505620 CTTCTTTGACACCACCCCCCTGG + Intergenic
1064852125 10:19720241-19720263 CCTCCTTGCCAACACTTTCTGGG + Intronic
1067232442 10:44421554-44421576 CCTGCCTGTCACCTCCTTCCAGG + Intergenic
1068169946 10:53380200-53380222 CCTCCTTTGCACTGCCTTCCTGG + Intergenic
1068283836 10:54909896-54909918 CCCCCTGGAGACCACCTCCCTGG - Intronic
1070825872 10:79390492-79390514 CATCCTTGCCAGCACCCTCCTGG + Intronic
1073865561 10:107800467-107800489 CCACCATGACACCACGTTACTGG + Intergenic
1074661545 10:115664093-115664115 TCTCATTGAGACTACCTTCCTGG + Intronic
1074961463 10:118449623-118449645 CCACCTCCACTCCACCTTCCAGG + Intergenic
1075713537 10:124543192-124543214 CCTCCCAGACTCCACCTCCCTGG + Intronic
1076616178 10:131756445-131756467 GCTCCTCGCCACCACCTGCCTGG + Intergenic
1076851704 10:133096506-133096528 CCTGCTTGTCAACATCTTCCGGG - Intronic
1077433793 11:2528575-2528597 CCCCCTGCACCCCACCTTCCAGG - Intronic
1077442456 11:2575001-2575023 CCACCTTGCCACCAGCCTCCCGG - Intronic
1078912834 11:15749360-15749382 CCTTCTTGAGCTCACCTTCCAGG - Intergenic
1080242923 11:30147553-30147575 CCTCCTCCCCACTACCTTCCTGG + Intergenic
1080652777 11:34235886-34235908 CCTCCTTGAAACAAACTTTCAGG + Intronic
1083764485 11:64835472-64835494 CCTCCCTGCCACCAGCTGCCTGG + Intronic
1084708532 11:70829901-70829923 CATTCTTGACACCACTGTCCTGG + Intronic
1084816944 11:71653494-71653516 TGTTCTTGACACCACCTTCTAGG - Intergenic
1084940264 11:72608688-72608710 CCTCCTTGACAGCACGTTGCAGG + Exonic
1085311999 11:75522405-75522427 CCTCCCTGACAAAGCCTTCCTGG + Intronic
1085691803 11:78670332-78670354 CCTCCTTCACACCTTCTACCTGG - Exonic
1087026018 11:93650577-93650599 CTTCCAGGACACCACCTTCTAGG - Intergenic
1089527104 11:119104371-119104393 CCTCCCTACCACCACCCTCCTGG + Intronic
1090189539 11:124759316-124759338 CCTCCTTGAAACCAACACCCCGG - Intronic
1090830186 11:130415909-130415931 CCTCCTTCAGACAACCTTCTCGG + Intronic
1092059388 12:5536144-5536166 CTTCCTGGACACCACCTTCCAGG - Intronic
1096146797 12:49284101-49284123 CCTCCTTCTCATCATCTTCCAGG + Intergenic
1096193329 12:49633852-49633874 CCTCCTGGACACCGCCCTTCTGG + Intronic
1096225908 12:49866944-49866966 CTTCCCTGACCTCACCTTCCTGG - Exonic
1098519844 12:71422700-71422722 CCTCCTGGCCACAGCCTTCCTGG + Intronic
1099698629 12:86055902-86055924 ACTCCTTGGCATCAGCTTCCAGG + Intronic
1099973469 12:89524406-89524428 CCTTCTTGACCCCAGCTCCCTGG + Exonic
1100574300 12:95875217-95875239 CCTCCCTCACACCTGCTTCCAGG - Intronic
1102029616 12:109732433-109732455 GCTCCTGGACGCCACCTGCCCGG + Intronic
1102145997 12:110655543-110655565 CCTCCTTCCCGCCACCCTCCTGG + Intronic
1103792890 12:123484092-123484114 CCTCCTTGGCACCTGCTCCCAGG - Intronic
1103986255 12:124769509-124769531 TCTCCAGGACACCACCCTCCAGG - Intergenic
1105638747 13:22240787-22240809 CCTCCTCCATCCCACCTTCCTGG + Intergenic
1106720539 13:32430463-32430485 CCTCCTTGAAACTCCCTCCCTGG - Intergenic
1107734477 13:43383838-43383860 CCTTCTGGACACCACCCTGCAGG + Intronic
1108370733 13:49764999-49765021 CTTCCATAACACCACATTCCTGG + Intronic
1111991619 13:95122669-95122691 CCTGCTTGCCTCCACCTACCAGG + Intronic
1112349810 13:98623330-98623352 CCTACTGGAAACCACCTTCCAGG - Intergenic
1112370607 13:98789832-98789854 CCTTCTTCACTCCACCTTCCAGG + Intergenic
1113840805 13:113360115-113360137 CTTCTTTGAGACCTCCTTCCTGG - Intronic
1114239701 14:20855194-20855216 CCCCCTTTACAGCACCTTGCGGG + Intergenic
1115307226 14:31945324-31945346 CTTCCCTGACACCACCTCCCTGG + Intronic
1117180186 14:53183458-53183480 TCTCCTGGGCACCACCCTCCAGG - Intergenic
1117680491 14:58198679-58198701 CCTCCTTGAAAGCAAATTCCTGG - Intronic
1117791067 14:59342851-59342873 CCTCCTTGACACCACCTTCCCGG - Intronic
1119740205 14:77009087-77009109 CATCCTTGGAACCATCTTCCAGG - Intergenic
1120686598 14:87544937-87544959 ACTCCTAGACACCCGCTTCCTGG + Intergenic
1121273586 14:92653084-92653106 CCTCCCTGCCACCTCCTCCCAGG - Intronic
1122312134 14:100804109-100804131 TCTCCTTGACACCTCCCTCAGGG + Intergenic
1122477164 14:102018400-102018422 CCTCCCTGACAGCGCCTCCCAGG - Intronic
1122636356 14:103131617-103131639 CCTCTCTGCCTCCACCTTCCAGG + Exonic
1122923963 14:104891408-104891430 GCTCCTGGCCACCTCCTTCCAGG - Intronic
1124010142 15:25831363-25831385 TCTCCTTGACAACATTTTCCTGG + Intronic
1124183298 15:27498817-27498839 CATCTTTGACTCCAACTTCCTGG + Intronic
1124910537 15:33915898-33915920 CTTGCTTTACCCCACCTTCCTGG + Intronic
1126412868 15:48389804-48389826 CCTCCTTGTCCCAACCTTTCAGG - Intergenic
1127055685 15:55128885-55128907 CCTCATTGACACCTGATTCCAGG - Intergenic
1127266683 15:57367823-57367845 TCTCCTTGACAGCTCCTACCCGG - Intergenic
1128538983 15:68511814-68511836 CCTCCTTGCCAATACATTCCAGG - Intergenic
1129460954 15:75699894-75699916 CCTCCTTTCCCCCACTTTCCTGG + Intronic
1129709085 15:77811126-77811148 CAGCCTTCCCACCACCTTCCCGG + Intronic
1129723865 15:77891823-77891845 CCTCCTTTCCCCCACTTTCCTGG - Intergenic
1130040112 15:80399483-80399505 CCACCTAGACACCACCTTGAAGG - Intronic
1130872688 15:87983742-87983764 CCTCCATTTCACCCCCTTCCTGG - Intronic
1132999511 16:2841902-2841924 CCTCCTCTAAACCACCTCCCTGG - Intergenic
1133885713 16:9825814-9825836 GCTCCTTGAGAACACATTCCTGG + Intronic
1133957561 16:10458258-10458280 CCTCCTTCACAGCAGCTTCCTGG - Intronic
1134063088 16:11210746-11210768 CCCCCCTCACACCACCTTGCAGG + Intergenic
1136525820 16:30829548-30829570 CCTCCTTGACATCCCCTCTCTGG - Intergenic
1139318743 16:66095809-66095831 CCTCCTTGACTTCAGCATCCTGG + Intergenic
1139661355 16:68423169-68423191 CCTCCTTGTCACCTCCTTTATGG + Intronic
1139927240 16:70496379-70496401 CTTTCCTGCCACCACCTTCCAGG - Exonic
1141638395 16:85327891-85327913 CCTCCTTGATACCACATTCCTGG + Intergenic
1141805346 16:86338009-86338031 CCACCTGGACACCACTTACCTGG + Intergenic
1141880581 16:86856365-86856387 CCTCCTGGAACTCACCTTCCAGG + Intergenic
1143386007 17:6530903-6530925 CCTCATTGACAGATCCTTCCAGG + Intronic
1144348292 17:14369583-14369605 CCTCCTTAACACGACCTTCGTGG - Intergenic
1148122389 17:45221076-45221098 CCTCCTTGGGACCACCTTGGCGG + Intergenic
1148509884 17:48159492-48159514 CTTTCTAGACACCACTTTCCGGG + Intronic
1148785065 17:50142236-50142258 CCTCCTCCACTCCACCTCCCTGG + Intronic
1150789913 17:68195711-68195733 CCCTCTTGACACCACCTCCTGGG - Intergenic
1150830156 17:68511967-68511989 CCTCCTTTCCACCCCCTCCCTGG - Intronic
1150917561 17:69451944-69451966 CCTCCTTGCCACCCACCTCCAGG - Intronic
1151148926 17:72066995-72067017 CCTCCTTAGCCCCACCTTCTGGG + Intergenic
1151170359 17:72240656-72240678 CCTACTTGACAACACGTGCCAGG - Intergenic
1151358049 17:73571883-73571905 CCCCCTTGACAACACATGCCGGG + Intronic
1155196450 18:23479322-23479344 CTTCCTTGACTCCTCCTTTCTGG - Exonic
1155962510 18:32006536-32006558 CTTACTTAACACCACCTACCAGG + Intergenic
1157008015 18:43609779-43609801 CATCCTTGACACCACAATCTTGG + Intergenic
1159126961 18:64235206-64235228 CAGCCTTGGCACCACCTCCCTGG - Intergenic
1160159478 18:76460349-76460371 CCTCCCTGTTACCACCTTCCAGG + Intronic
1160680375 19:409277-409299 CCTCCCTGCCACCAGCCTCCGGG - Intergenic
1161152266 19:2716200-2716222 ACTCCAGGACGCCACCTTCCCGG + Exonic
1161406124 19:4092116-4092138 GGTCCTGGACACCACCCTCCTGG - Intronic
1161542677 19:4861440-4861462 CCTGCCTGGCCCCACCTTCCAGG + Intronic
1162760767 19:12887025-12887047 CCACCTAGACCCCACCTTCTAGG + Intronic
1164694624 19:30234007-30234029 CCTTCCTGCCACCACCTACCTGG - Intronic
1165184301 19:34003707-34003729 CTTTCTTTACCCCACCTTCCAGG - Intergenic
1165894946 19:39136023-39136045 CTTCCTCGCCACCCCCTTCCTGG + Intronic
1166133891 19:40763703-40763725 CCTCCTGGCCATCACCCTCCAGG - Intronic
1166603660 19:44120309-44120331 CCTCTTAGACATCACATTCCTGG - Intronic
1167001895 19:46750406-46750428 CCTGCTGGGCACCTCCTTCCTGG + Intronic
1167114976 19:47483880-47483902 CCTTCTCAACACCACGTTCCAGG + Intronic
1167141027 19:47650913-47650935 CCATCTTGACACCATCTGCCTGG + Intronic
1167738632 19:51311585-51311607 CCCCCTTGACCCCGCCTCCCCGG + Intergenic
925857309 2:8142188-8142210 CCTCCCTGAAAGCACCTTCCTGG - Intergenic
926971571 2:18472352-18472374 CTTCCATAACACCACCTTCCAGG + Intergenic
927640580 2:24842998-24843020 CCTCCTTGATGCCTCCTCCCCGG - Intronic
929458793 2:42085975-42085997 CGTCCTTCACACCTCATTCCTGG - Intergenic
929620867 2:43352760-43352782 CATCCCTACCACCACCTTCCAGG + Intronic
932739406 2:74280308-74280330 CTTCCTTGACCCCTCCTGCCTGG + Intronic
935262287 2:101365674-101365696 CCTTCTTGGCACCATTTTCCTGG + Intronic
936943407 2:117908920-117908942 TCTCCTTGAAACCTTCTTCCTGG - Intergenic
937233388 2:120415820-120415842 CCTCCTGGCCTCCACCTGCCAGG + Intergenic
946116162 2:217464353-217464375 CCTCCTTTCTACCATCTTCCTGG + Intronic
947518959 2:230829255-230829277 CGTCCTCGTCACCACCTCCCTGG - Intergenic
947612941 2:231534969-231534991 CCTCCTTAACACCTACTCCCTGG - Intergenic
947627253 2:231627741-231627763 CCTCCCTCCCACCACATTCCAGG + Intergenic
947837862 2:233188317-233188339 CCTCCCTGCCACCGCCTGCCAGG + Intronic
948082084 2:235214688-235214710 CCTCCTTGCCCCAACCTCCCAGG - Intergenic
948100582 2:235369764-235369786 CCTCCTTCAAGCCATCTTCCTGG - Intergenic
949047266 2:241877755-241877777 CCCCCTTCCCACCCCCTTCCTGG + Intergenic
1168838362 20:892870-892892 CCTCCTTGACACTGCCCTCAAGG + Intronic
1171404026 20:24897783-24897805 CTTCCTGGGCACCACCCTCCAGG + Intergenic
1172129524 20:32646539-32646561 CCTTCTAGACACCACCTGCTAGG - Intergenic
1173224222 20:41152545-41152567 CATCCTTGATACCATCTTTCTGG + Intronic
1173225771 20:41161724-41161746 CCTCCTTGACACCACCTTCCAGG + Intronic
1173565957 20:44038945-44038967 CCTCCGTGTCTCCTCCTTCCTGG + Intronic
1174144576 20:48442495-48442517 CCTCTTTCACACCAGCTACCGGG - Intergenic
1175286779 20:57841802-57841824 TTTCCATGAGACCACCTTCCTGG - Intergenic
1175475533 20:59271204-59271226 GCTCCTCAACACAACCTTCCAGG + Intergenic
1175767050 20:61599053-61599075 ACTTCTTGACACCACGTCCCTGG + Intronic
1175942289 20:62543026-62543048 CCTCCTTCACACATCTTTCCAGG - Intergenic
1176069174 20:63217120-63217142 CCTGCCTGACACCCCATTCCAGG - Intergenic
1177751219 21:25286313-25286335 CATCCTTGTAACCACCATCCAGG - Intergenic
1178660454 21:34503366-34503388 CCTCCTAGGGACCACCCTCCAGG + Intergenic
1179818371 21:43922426-43922448 CCTCCTTAACCCCACCCTCAAGG + Intronic
1179818387 21:43922482-43922504 CCTCCTTAACCCCACCCTCAAGG + Intronic
1180068103 21:45422760-45422782 CCTTCCTGACACCACCCACCAGG - Intronic
1180922102 22:19526215-19526237 CTTCCATGCCACCATCTTCCTGG + Intronic
1181013529 22:20055764-20055786 CCTCCATGACCCCGCCTGCCAGG + Intronic
1182293728 22:29300994-29301016 CCTCCATCAAACCATCTTCCTGG + Intergenic
1182501834 22:30753560-30753582 CCTCCCATCCACCACCTTCCTGG - Intronic
1185148781 22:49152808-49152830 CCTCCCTGTCACCCCCTCCCAGG + Intergenic
950740354 3:15046076-15046098 CTTCCTTAAAAACACCTTCCAGG - Exonic
953614642 3:44478618-44478640 TCACCTTGTCACCATCTTCCTGG - Intergenic
953677878 3:45017390-45017412 CCTCCTTCCCACAACCTTGCAGG + Intronic
953870997 3:46627577-46627599 CCTTCCTGACCCCACCCTCCAGG - Intergenic
956878251 3:73484853-73484875 CCTCCTTTATACCAGCTTCTAGG - Intronic
957070725 3:75565874-75565896 TGTCCCTGACACCACCTTCTAGG + Intergenic
960946317 3:122969280-122969302 CCTGCTTCCCACCTCCTTCCAGG + Intronic
964444225 3:156741940-156741962 CCCCCTAGACCCCACCTTCAAGG - Intergenic
966909304 3:184549855-184549877 CCTGCTTAGCACCACCTGCCCGG - Intronic
967859559 3:194141146-194141168 CCTCGTCGTCACCACCGTCCCGG + Intergenic
968074861 3:195810672-195810694 CCTCCTCCGCACCACCCTCCCGG + Intronic
969232459 4:5841246-5841268 CCTGCAGGACACCCCCTTCCAGG + Intronic
969535693 4:7755079-7755101 CCTCCTTGCCACCCCCAGCCAGG - Intergenic
970569534 4:17366248-17366270 CTGCCTGGACTCCACCTTCCAGG + Intergenic
971167283 4:24197173-24197195 CCTCCTTGATCCCCCCTTCTTGG - Intergenic
973646195 4:52953525-52953547 TCCCCTTGACACCACCTTCAGGG - Intronic
978224745 4:106320675-106320697 CTTCCTTGTCACCTCCTTTCAGG - Intronic
978713099 4:111809337-111809359 CTTCCTAGAGACCACCTCCCAGG - Intergenic
979130619 4:117039942-117039964 CATCCTTGACGGCATCTTCCAGG - Intergenic
982122880 4:152159177-152159199 CCTCTTTTACACAACCTGCCAGG + Intergenic
982411665 4:155084698-155084720 CTTCCCTGGCTCCACCTTCCCGG - Intergenic
983792407 4:171813805-171813827 CCTCCTTTCCACCAGGTTCCCGG + Exonic
983989909 4:174105988-174106010 CCTCTTTGAGGCCACCTTCCTGG - Intergenic
985260020 4:188106501-188106523 CCTCTTTGACTCCATCTTCGCGG + Intronic
985534110 5:453611-453633 CCGCCGTGACCCCACCTTGCTGG + Exonic
985769858 5:1802073-1802095 CCTCCTTAGCTCCACCTTCCCGG + Intronic
986053098 5:4108545-4108567 CCTCCTGAACACCACCTTTCAGG - Intergenic
986124666 5:4874202-4874224 CCTCCTGCACTCCACCTTGCAGG + Intergenic
986648820 5:9944463-9944485 CCTGCTTGCCACCCCTTTCCCGG - Intergenic
987463995 5:18250825-18250847 CACCCTTGCCACCATCTTCCCGG + Intergenic
988342083 5:29985604-29985626 CATCCTTGACACCTGCTTTCAGG + Intergenic
988730329 5:33966376-33966398 CCCACTTGAAACCACCTTCTGGG - Intronic
995387446 5:111603406-111603428 CCTCCTTCTCAGCACTTTCCTGG - Intergenic
995659161 5:114461813-114461835 CCTCCTTGCCACCACAGCCCTGG + Intronic
995879233 5:116825338-116825360 CATGCTTGACACAACCTACCAGG - Intergenic
997381350 5:133440564-133440586 CCTCCTTGGCACATCCATCCTGG - Intronic
997590112 5:135067157-135067179 CCTCCCTGACCCCTCCTTGCCGG + Intronic
998353550 5:141516265-141516287 CCACCTTTACCCCACCTTCCTGG - Exonic
998792577 5:145781064-145781086 CCTCCTCCCCACCGCCTTCCTGG + Intronic
999435805 5:151562460-151562482 CCTCATTGACACCACCTGCCTGG - Intronic
999702931 5:154244758-154244780 CCTCCTTGAGACCTGGTTCCAGG - Intronic
1000202811 5:159028287-159028309 CTTCCTTGTCACCAAGTTCCTGG - Intronic
1001246846 5:170111311-170111333 GCCCCTTCACACCTCCTTCCTGG - Intergenic
1001704777 5:173733957-173733979 CCGCCTTGGCACCACCTTCTTGG - Intergenic
1001978589 5:176021471-176021493 CCTCCCAGGCACCACCTCCCTGG - Intronic
1002133563 5:177095433-177095455 CCGCCTCGGCCCCACCTTCCTGG - Exonic
1002238828 5:177822291-177822313 CCTCCCAGGCACCACCTCCCTGG + Intergenic
1002419032 5:179135981-179136003 CTTCATGGACACCACCTCCCCGG + Exonic
1002525600 5:179814237-179814259 CCTCCCTGACATAACCATCCAGG + Intronic
1002782795 6:379988-380010 CCTCCTGGGCAGCACCCTCCCGG + Intergenic
1003426204 6:5999849-5999871 CCTCCTTCCCACAACCTGCCTGG + Intronic
1004409009 6:15362955-15362977 CCCTCTCCACACCACCTTCCTGG - Intronic
1004620292 6:17325464-17325486 CCACATTGACCCCACCTCCCAGG - Intergenic
1004832651 6:19494271-19494293 ACTCCTTGAGACCAAATTCCTGG - Intergenic
1005605905 6:27477296-27477318 GCTTCTCGCCACCACCTTCCAGG - Intergenic
1005926426 6:30449381-30449403 CTTCCTAGCCACCAGCTTCCTGG - Intergenic
1005928150 6:30461953-30461975 CTTCCTAGCCACCAGCTTCCTGG - Intergenic
1006107676 6:31726432-31726454 CCTCCTTCACACTATCTGCCTGG + Intronic
1006171049 6:32092951-32092973 CCAACTTGGCACCACCATCCTGG + Intronic
1006791547 6:36704391-36704413 TCTCCTTGGCACCACAGTCCTGG - Exonic
1007088499 6:39167383-39167405 GCTCCTGGACACCTCCTTCAAGG + Intergenic
1007488390 6:42198478-42198500 CTTCCTTGACCCCACATTCAGGG + Intergenic
1007554593 6:42755358-42755380 CTTCAGAGACACCACCTTCCAGG - Intronic
1008536227 6:52508311-52508333 CCCCCTTGTCTCCAGCTTCCAGG - Exonic
1011667892 6:89652991-89653013 CCTCATGGACACGATCTTCCAGG - Exonic
1011728527 6:90235577-90235599 CCTCTTTGCCTCCACCTCCCAGG - Intronic
1013288521 6:108700104-108700126 CCCCCTTCACCCCACCTTCAGGG - Intergenic
1017971738 6:159317755-159317777 CCTCCTTGAGACCACGGTCGTGG - Intergenic
1018755262 6:166843110-166843132 CCGCCTTTACCCCACTTTCCTGG + Intronic
1019909761 7:4092699-4092721 CCTCTCTGACATCACCTCCCTGG - Intronic
1022115920 7:27260292-27260314 CCTCCTTTGCACTTCCTTCCTGG - Intergenic
1022242798 7:28529298-28529320 CCACCTTGGCACCTCCTTCGGGG - Intronic
1022329760 7:29366421-29366443 CTTCCATGGCACCACCCTCCTGG - Intronic
1022464539 7:30644716-30644738 CCTACTTGTCACCACCTTCGTGG + Intergenic
1024123491 7:46268275-46268297 CCTCCTTGAGACCATTCTCCAGG - Intergenic
1024441399 7:49422906-49422928 CCTCCTTACCATGACCTTCCTGG + Intergenic
1024678792 7:51661882-51661904 CCTCCTTGGCAGCACCTCCGTGG - Intergenic
1025875616 7:65477740-65477762 CCTTGTTGACCCCACCTCCCGGG + Intergenic
1026592707 7:71710820-71710842 CCTCCCTGACACCCGCTGCCTGG + Exonic
1027198444 7:76047647-76047669 CCTCCCTGACCCTACCTTTCCGG + Exonic
1032274065 7:130439526-130439548 CCTCCTTCCCCCCACCCTCCAGG + Intronic
1032458047 7:132088311-132088333 GCTCGATGACACCACCATCCCGG - Intergenic
1034416514 7:150967611-150967633 CCTACTTGACACCACATACGGGG + Intronic
1035684118 8:1510453-1510475 CATCCTTGACAGCACTTTCACGG - Intronic
1036206272 8:6807607-6807629 TCTCCTTGTCACCAGCTCCCAGG - Intergenic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1038049398 8:23794926-23794948 CCTCCTTGCAACCACTTTACAGG - Intergenic
1038292875 8:26265710-26265732 CCTCCTTCAAACCATCTCCCTGG + Intergenic
1039931235 8:41991525-41991547 CATCCATGAAACCACCATCCAGG - Intronic
1041172242 8:55156089-55156111 CCTCCTAAAGGCCACCTTCCTGG - Intronic
1042374440 8:68032920-68032942 CCTCCTGCAGACCACCTTCAGGG + Intronic
1044199064 8:89413050-89413072 CCTCCATGACGACAGCTTCCAGG + Intergenic
1045996651 8:108370317-108370339 CCTCTGGGACACCACCCTCCAGG - Intronic
1047894759 8:129354215-129354237 CCCCCATGCCACCACCTTCCAGG + Intergenic
1049402544 8:142436043-142436065 CCTCCTCTCCTCCACCTTCCTGG + Intergenic
1049814774 8:144593116-144593138 CCGCCTTGACAGCAGCTTCTGGG - Intronic
1050191566 9:3032006-3032028 CCTACTAGACACCACGTTCCTGG + Intergenic
1051138386 9:13950401-13950423 CCTCCTACTCCCCACCTTCCAGG - Intergenic
1051221291 9:14851107-14851129 GCTCATTGACCCCACCTGCCTGG + Intronic
1057185678 9:93056382-93056404 CCTCCTTGATCCCACCTGTCAGG + Intergenic
1059767496 9:117397320-117397342 CCTCCTAGAAACCACTTTCTTGG - Intronic
1060825744 9:126686978-126687000 CCTCCTTCTCACCACCACCCCGG - Intronic
1186230615 X:7449822-7449844 TCTCCTTCCCTCCACCTTCCAGG + Intergenic
1188137233 X:26504972-26504994 CCTCCTCCACCCCAACTTCCTGG + Intergenic
1190630957 X:52385497-52385519 GCTCCTTGAGATCAGCTTCCAGG - Intergenic
1194765514 X:97843237-97843259 CCGCCTTGATCCCACCTCCCCGG + Intergenic
1199034061 X:143031176-143031198 CCTCCTTCACCACTCCTTCCTGG - Intronic
1199986658 X:152957554-152957576 TCTCCTTGTCTCTACCTTCCAGG - Intronic
1201227124 Y:11828888-11828910 CCTCCTTGACACAACCTATTTGG - Intergenic