ID: 1173226028

View in Genome Browser
Species Human (GRCh38)
Location 20:41162932-41162954
Sequence CAGGAAACAGAACCTGGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 301}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173226028_1173226033 -1 Left 1173226028 20:41162932-41162954 CCCTGACCAGGTTCTGTTTCCTG 0: 1
1: 0
2: 2
3: 24
4: 301
Right 1173226033 20:41162954-41162976 GCAGATGGACCTCCCCTTCTTGG 0: 1
1: 0
2: 2
3: 6
4: 143
1173226028_1173226038 16 Left 1173226028 20:41162932-41162954 CCCTGACCAGGTTCTGTTTCCTG 0: 1
1: 0
2: 2
3: 24
4: 301
Right 1173226038 20:41162971-41162993 TCTTGGAAGCCAGTACTCTGAGG 0: 1
1: 0
2: 0
3: 25
4: 168
1173226028_1173226039 21 Left 1173226028 20:41162932-41162954 CCCTGACCAGGTTCTGTTTCCTG 0: 1
1: 0
2: 2
3: 24
4: 301
Right 1173226039 20:41162976-41162998 GAAGCCAGTACTCTGAGGTTTGG 0: 1
1: 0
2: 4
3: 16
4: 172
1173226028_1173226041 26 Left 1173226028 20:41162932-41162954 CCCTGACCAGGTTCTGTTTCCTG 0: 1
1: 0
2: 2
3: 24
4: 301
Right 1173226041 20:41162981-41163003 CAGTACTCTGAGGTTTGGTTTGG 0: 1
1: 0
2: 0
3: 15
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173226028 Original CRISPR CAGGAAACAGAACCTGGTCA GGG (reversed) Intronic
901061293 1:6473175-6473197 CTGGAAAGATACCCTGGTCAGGG + Intronic
901415335 1:9112370-9112392 CGGGGAACAGAACCTGGCAAGGG + Intronic
901627036 1:10630306-10630328 CAGCAAACACACCCTGGGCAAGG - Exonic
901898189 1:12333246-12333268 CAGGATACAGAGCATGGCCAAGG - Exonic
901944533 1:12691063-12691085 CAGGAAGCTGAAGTTGGTCAGGG + Intergenic
902788628 1:18749847-18749869 CAGGAAAAGGGACCTGGGCAGGG + Intergenic
903820996 1:26102523-26102545 CAGGACACAGAGCTTGGTCAAGG + Intergenic
904074248 1:27828009-27828031 CTAGAAACAGAACATGGCCAAGG + Intergenic
905048033 1:35023992-35024014 GAGGTAAAAGAAACTGGTCAGGG - Intronic
905093018 1:35444884-35444906 CAGCAAACAGATTCTGGGCATGG - Intronic
905241015 1:36581541-36581563 CAGGAAACAGGACTTGCTCAGGG + Intergenic
907269568 1:53282928-53282950 CAGGAAACAGAACCTCTCAAGGG + Intronic
908636584 1:66173380-66173402 CTGGAGTCAGAAACTGGTCAGGG + Intronic
909603983 1:77490296-77490318 CAAGAAACAGCACCAGCTCAGGG - Intronic
910143234 1:84050446-84050468 CAGGAAATAGAATCAGGTGATGG - Intergenic
910999080 1:93143466-93143488 CATGAAACAAAACCATGTCATGG - Intergenic
913676859 1:121149066-121149088 CAGGAAACAGGCTCTGGTCAAGG + Intergenic
914028752 1:143937018-143937040 CAGGAAACAGGCTCTGGTCAAGG + Intergenic
915008371 1:152661980-152662002 CAGGGAACAGAATCTCGTCCAGG + Intergenic
915009770 1:152674998-152675020 CAGGGAACAGAATCTTGTCCAGG + Intergenic
915010813 1:152684727-152684749 CAGGGAACAGAATCTTGTCCAGG + Intergenic
917481470 1:175415510-175415532 CATCAAACAGCACGTGGTCAGGG - Intronic
917882821 1:179355821-179355843 CAGGAAACAGAGGCCGGGCACGG - Exonic
920464218 1:206167908-206167930 CAGGAAACAGGCTCTGGTCAAGG + Intergenic
923137563 1:231131869-231131891 CAGAAAACAAAGCCTGGGCATGG + Intergenic
924436915 1:244049598-244049620 GAGAAAACAGACCCGGGTCACGG - Intronic
1069899437 10:71698746-71698768 CAGGAAACAGAATTTGGAGAGGG - Intronic
1073070902 10:100792666-100792688 CAGGAGGCAGAAACTGGCCAAGG + Intronic
1073284546 10:102379843-102379865 GAGGAAACAGCACCTGGTGGGGG - Exonic
1074774059 10:116753425-116753447 CAAAAGACAGAACCTGGTCTTGG - Intergenic
1075381446 10:122022064-122022086 CTGTAAAAAGAACCTAGTCAAGG - Intronic
1075604121 10:123792110-123792132 CAGAAAACAAAACCAGGACAGGG + Intronic
1075998176 10:126894846-126894868 GAAGAAACAGCACCTGGGCAGGG - Intergenic
1077260688 11:1618180-1618202 CCTGAAAGAGAAGCTGGTCAAGG + Intergenic
1077698293 11:4415234-4415256 CAGGAAATAGAAACCTGTCAAGG + Intergenic
1078621608 11:12913886-12913908 CAGGAAACAGGACCTTTTTATGG - Intronic
1081841007 11:46201411-46201433 CGGGAAACACAACCTGGGGAAGG - Intergenic
1083064659 11:59912498-59912520 CAGGAAACAGAAGGAGGTTAAGG - Intergenic
1085043055 11:73338138-73338160 TAGGAAACAGGACCTGACCAGGG + Intronic
1085128220 11:74016518-74016540 CAGGAATCAGAACAAGGACAAGG + Intronic
1085227148 11:74932311-74932333 CAGGAAACACACCCTGGAGAGGG - Intronic
1087033325 11:93728678-93728700 CAGGAAACAGAAACTGGCCATGG + Exonic
1087388080 11:97498418-97498440 CAGGCAACAAAACCTGGCCATGG + Intergenic
1089222994 11:116890794-116890816 CAGAAAACAGAACTTGTTCAGGG + Intronic
1091678244 12:2507169-2507191 CAGGAAACAGAGGCTGGCGAAGG - Intronic
1092673958 12:10895705-10895727 CAGGAAACATATCCTGGAGATGG + Intronic
1094186391 12:27647315-27647337 TAAGAAAAAGAACCTGGCCAGGG - Intronic
1095320329 12:40819170-40819192 CAGGAAGCAGGACCTGTTTAAGG + Intronic
1098042422 12:66365613-66365635 CAGCAAACAGAACATTATCAGGG - Intronic
1100666733 12:96762410-96762432 CAGGAAAGAAAACCCGGGCAAGG - Intronic
1100928976 12:99584759-99584781 CAGGCAACAGAACATGAGCAGGG + Intronic
1101655695 12:106718115-106718137 CAGCCAACAGAACTTGGACATGG - Intronic
1108309435 13:49172542-49172564 CAGCCTACAGAAGCTGGTCAAGG - Intronic
1109086337 13:57975613-57975635 CAGGATAAAGAAAGTGGTCAGGG + Intergenic
1109537088 13:63736973-63736995 CAGGGAACAGAACATGGCTAAGG + Intergenic
1110527618 13:76557241-76557263 CAGAAAACAGAAACTGGTTCTGG + Intergenic
1110621345 13:77599218-77599240 CAGGAAACAGAAGCTTGTTGGGG - Intronic
1111990166 13:95108524-95108546 CAGGCAAGAGAACATGTTCAAGG - Intronic
1113957838 13:114108591-114108613 AAGAAAACAGCACCTGGTGATGG - Intronic
1116296521 14:43118786-43118808 CAGGCAACAGAGCATGTTCAAGG + Intergenic
1116868186 14:50048237-50048259 CATGAACCAGGACATGGTCAGGG - Intergenic
1118482433 14:66180667-66180689 CAGGAGAAAGGTCCTGGTCAAGG - Intergenic
1118730025 14:68659543-68659565 CAGGAAACAGGACCTTGGGAGGG + Intronic
1119561698 14:75595400-75595422 CAGCAAACACAACCTCCTCAAGG - Intronic
1121546521 14:94767614-94767636 CAGGGAGCAGCACCTGGTCCCGG + Intergenic
1121613669 14:95298427-95298449 AAGGAACCAGAAACTGTTCAAGG + Intronic
1122128727 14:99593034-99593056 CGGGAAACAGAGCCTTGGCATGG + Intronic
1122290605 14:100678519-100678541 CAGGAAACAGCGGCTGGGCAAGG + Intergenic
1125530940 15:40412963-40412985 CAGGAAACAAAAGGTGGTCCTGG - Intronic
1126497257 15:49305757-49305779 CAGGAAAGAGAATCTGATAAAGG + Intronic
1127298094 15:57627460-57627482 CAGGAAACTCAACCTGGTAGAGG + Intronic
1127455884 15:59155724-59155746 GAGGAGACAGAGCCGGGTCAAGG + Intronic
1127875215 15:63106149-63106171 CAGGAACCAGATCCTGACCATGG - Intergenic
1127978811 15:64018798-64018820 CAGAAAACAGAAACTGCTAAAGG - Intronic
1129522817 15:76196459-76196481 CTGGACACAGTTCCTGGTCAAGG - Intronic
1130900608 15:88204524-88204546 CTGGAAGGAGAACCTGGCCAAGG - Intronic
1130939225 15:88493982-88494004 CTGCAAACAGCAGCTGGTCAGGG + Intergenic
1132870892 16:2115347-2115369 CAGGGAACAGACCCAGGTCAGGG + Intronic
1134521633 16:14921536-14921558 CAGGGAACAGACCCAGGTCAGGG - Intronic
1134709304 16:16320187-16320209 CAGGGAACAGACCCAGGTCAGGG - Intergenic
1134716515 16:16360216-16360238 CAGGGAACAGACCCAGGTCAGGG - Intergenic
1134950300 16:18348458-18348480 CAGGGAACAGACCCAGGTCAGGG + Intergenic
1134958235 16:18391943-18391965 CAGGGAACAGACCCAGGTCAGGG + Intergenic
1139185731 16:64804113-64804135 CAGAAGACAGAAACTGTTCATGG + Intergenic
1139551162 16:67673880-67673902 AAGGGAACAGAACTTGGTCCAGG + Intergenic
1139945124 16:70635581-70635603 CTGGAAACAGCTCCTGCTCAAGG - Intronic
1140413010 16:74752802-74752824 CAGGACACTTACCCTGGTCAGGG - Intronic
1141719652 16:85749247-85749269 GAGGAAACAGAAGCTTGTAAAGG - Intronic
1144725115 17:17497960-17497982 CAGGAATCAGAGCCAGGCCAGGG - Intergenic
1144992393 17:19242572-19242594 CAGGAAACAGAATCAGGAAAAGG - Intronic
1145289605 17:21532964-21532986 CAGGAAACACTGCCTGGCCATGG + Exonic
1147311882 17:39600306-39600328 CAGGATTCAGAACCGGGGCAGGG + Intergenic
1147391480 17:40111949-40111971 CTGGAAATAGCACCTGGTAATGG + Intergenic
1149425588 17:56551395-56551417 GAGGAAAGGGAACCTGGTTAGGG + Intergenic
1150942115 17:69704038-69704060 CAGGAAAGAGAAGGTGGACATGG - Intergenic
1150980679 17:70138297-70138319 CAGCAGACAGACCCTGGACATGG - Intergenic
1151744314 17:76003486-76003508 CAGGAAAGAGACCCTGGCCTTGG - Intronic
1152241000 17:79161133-79161155 CAGAAAACAAAGCCTGGTTATGG + Intronic
1152942392 17:83179607-83179629 CAGGACACAGAAGCTGGTTTTGG + Intergenic
1153704730 18:7733872-7733894 CAGAAAAGAGAACCTGCCCAGGG - Intronic
1156309730 18:35910833-35910855 CAGGTAACAGAACCTGACCATGG - Intergenic
1156359861 18:36375437-36375459 CAGGAGACAAACCCTGGTCCTGG - Intronic
1156748559 18:40421916-40421938 CAGGGAGCAGAATATGGTCATGG + Intergenic
1157579057 18:48762973-48762995 CAGGAATGGGAACCTGATCAGGG - Intronic
1158524335 18:58198589-58198611 CATGAGACAGAACTTGGTCTGGG - Intronic
1158653347 18:59307359-59307381 CAGGAACCTGAACCTGTTCTAGG + Intronic
1159898253 18:74017590-74017612 CATGAAACAGAAAGTGGGCATGG - Intergenic
1161029186 19:2050201-2050223 CAGGAAACAGCACTTGGGCCTGG + Intronic
1161325320 19:3660912-3660934 CTTGAAACAGAACATGTTCAGGG - Intronic
1161685335 19:5699846-5699868 CAGGAGTCAGAGCCTGGGCATGG - Intronic
1162016217 19:7847900-7847922 CAGGAAGGAGAAGCTGCTCAAGG + Exonic
1163709143 19:18835288-18835310 CAGGAAAATGAACCTGATCGAGG + Intronic
1164952201 19:32345925-32345947 CAGAAGACAGAACCGGGACACGG - Intronic
1165153714 19:33775145-33775167 CAGGAAAGTGTCCCTGGTCATGG + Intergenic
1166891858 19:45998953-45998975 GAGGAAACAGGAGGTGGTCAGGG + Intronic
1167468218 19:49661413-49661435 CAGTACACAGAGCCTGCTCAGGG - Intronic
1168720844 19:58554288-58554310 CAAGAAGCAGAACAGGGTCACGG + Exonic
1202646118 1_KI270706v1_random:143688-143710 CAGGCAACAACACCTGGGCACGG + Intergenic
925845054 2:8027355-8027377 CAGTCACCAGAAGCTGGTCATGG - Intergenic
925885784 2:8392725-8392747 CTTGAAACAGAACCAGGTCTGGG + Intergenic
926298676 2:11586966-11586988 CAGGAAACAGAGCTAGGACAGGG + Intronic
926705767 2:15836359-15836381 GAGGAAACAGAAGTGGGTCAGGG + Intergenic
927139942 2:20122998-20123020 CAGGAATCAGGACCAGTTCAGGG - Intergenic
927276425 2:21266218-21266240 CAGGACACAGTTCCTGGTCTGGG - Intergenic
927784175 2:25961043-25961065 TAGGAAGCAGAACCTGCTAAAGG + Intronic
927786675 2:25979700-25979722 CAGGGAGCAGAATCTGTTCATGG + Intronic
927857051 2:26534453-26534475 GTGGAAACAGAGCCTGGACATGG - Intronic
928664302 2:33535641-33535663 CAGGAAGGAGAACATGCTCATGG - Intronic
931167552 2:59764422-59764444 CTGGACACAGAATCAGGTCATGG + Intergenic
932001578 2:67890000-67890022 TAGGTAAAACAACCTGGTCATGG + Intergenic
933139265 2:78773775-78773797 CAGGCAAGAGAGCCTGGGCAGGG - Intergenic
933598682 2:84308008-84308030 CATGAAAGAGAACCTGTCCAGGG - Intergenic
934634416 2:95970150-95970172 CAGGATACAGAGCAGGGTCAAGG + Intronic
934799215 2:97135089-97135111 CAGGATACAGAGCAGGGTCAAGG - Intronic
935473717 2:103491680-103491702 AAGTAAACAGAAAATGGTCAGGG - Intergenic
936463420 2:112727411-112727433 CAGGAAACAGGGCCTGGTGGCGG + Intronic
936783161 2:116058766-116058788 CTGGAAGCAGAAGCTGGTGAAGG + Intergenic
936846730 2:116843425-116843447 CAGGCAAGAGAACCTGTGCAGGG + Intergenic
938612711 2:132965291-132965313 CAGGAAACAAGTCCAGGTCATGG + Intronic
939350606 2:141033114-141033136 CAGAAAACAGCACGTGGTAAAGG + Intronic
939466503 2:142562925-142562947 CAGGGACCAGCACCTGGACAAGG - Intergenic
939818359 2:146924046-146924068 CAGGAAACCAAAGCAGGTCAAGG + Intergenic
940444596 2:153763504-153763526 CAGGCAAGAGAGCCTGGGCAGGG - Intergenic
940480806 2:154228375-154228397 CAGGACACAGAATCAGTTCATGG - Intronic
941081856 2:161070946-161070968 CAGGAAATAGAACCCTATCATGG - Intergenic
943144086 2:184019265-184019287 CAGGAGACAGAACATGCACAGGG - Intergenic
943976761 2:194489866-194489888 CAGGAAACAGAGCCTGTTCATGG + Intergenic
946521574 2:220470241-220470263 CAGGCAACAGAACTTGTACAGGG - Intergenic
947053912 2:226078686-226078708 CAAAAAACAGAATCTGATCAGGG - Intergenic
947237621 2:227959394-227959416 CAGGAAACAGCACCTGCCAAAGG - Intergenic
949053763 2:241912762-241912784 CATAAAACAGAATCTGGTGATGG + Intergenic
1169323049 20:4651051-4651073 AAAGAAACAGAGGCTGGTCATGG - Intergenic
1170553750 20:17499104-17499126 CAGGAAAAGGAACCTGGACTCGG + Intronic
1171186616 20:23127837-23127859 CAGGAGACAGAAACTAGGCAAGG + Intergenic
1172781956 20:37441987-37442009 CTGGAAACAAAACCTGATAAAGG - Intergenic
1172803323 20:37593634-37593656 CAGGAGACAGCACCAGGTGATGG + Intergenic
1173226028 20:41162932-41162954 CAGGAAACAGAACCTGGTCAGGG - Intronic
1174591129 20:51645968-51645990 CAGAAAACACAACCTCGTTAAGG + Intronic
1175492659 20:59389686-59389708 CAGGAAGCAGACCCTAGACAAGG + Intergenic
1175496536 20:59418393-59418415 CAGGAAACATGACCGGGTGAAGG - Intergenic
1175507942 20:59499495-59499517 CAGGAAACAGAGCCTTATGAGGG + Intergenic
1176097924 20:63352800-63352822 CAGGAAACGGGACAAGGTCAGGG + Intronic
1176605759 21:8829059-8829081 CAGGCAACAACACCTGGGCACGG - Intergenic
1177497384 21:21907518-21907540 CAGGAAATGGAGCCTGGCCAAGG - Intergenic
1178438568 21:32580725-32580747 CAGGAAACAGAACCCAGACAAGG + Intronic
1178617756 21:34148218-34148240 GAAGAAACTGAACATGGTCAAGG - Intergenic
1178998745 21:37433369-37433391 CAGGAAACAGTCCCTTGACATGG + Intronic
1180070751 21:45434894-45434916 CAGGAACCAGGGCCTGGTCTAGG - Intronic
1180348056 22:11720664-11720686 CAGGCAACAACACCTGGGCACGG - Intergenic
1180355830 22:11838758-11838780 CAGGCAACAACACCTGGGCACGG - Intergenic
1180382427 22:12153569-12153591 CAGGCAACAACACCTGGGCACGG + Intergenic
1181766467 22:25095780-25095802 CAGGAAACAGAACCATGAAAAGG - Intronic
1183204284 22:36407926-36407948 CAGGAAAGAGAACCTGGCTGTGG - Intergenic
1183739911 22:39663708-39663730 CAGGACCCGGAACCTGGGCAGGG - Exonic
1184039834 22:41936274-41936296 CATGAAACAGACCGTTGTCATGG - Intergenic
1184097341 22:42323657-42323679 CAGGAACCAGACTCTGGCCATGG + Intronic
1184821848 22:46915390-46915412 CAGAGAACAGAGCCTGGTAATGG + Intronic
1185195939 22:49469697-49469719 TAAGAAACAGCCCCTGGTCAGGG + Intronic
1185224717 22:49645945-49645967 CATGAATCAGGCCCTGGTCATGG + Intronic
950342932 3:12263667-12263689 AAGGAAACAGAACTGAGTCAGGG - Intergenic
950633382 3:14298823-14298845 CAGGAAGCAGACTCTGGCCAGGG - Intergenic
951024241 3:17813316-17813338 CAGGCAACAGAGCTTGGACAGGG - Intronic
951181262 3:19661818-19661840 GAGGAAACAGAACCGGGAAAAGG - Intergenic
952234215 3:31462538-31462560 CAGGAAACAGAAGCTACTCTAGG - Intergenic
952279438 3:31908939-31908961 CAGGAAGCAGAGCCAGGTCAAGG + Intronic
953268583 3:41417313-41417335 CAGGGAAGAGAGCCTGGTAAAGG + Intronic
953911248 3:46894078-46894100 CAGGATACAGAGCCAGGTGAAGG + Intronic
956323374 3:68024258-68024280 TAGGAAACAAAACCTTGTAAGGG + Intronic
956780694 3:72600883-72600905 GAGGGAACAGAACCTGCTCAGGG + Intergenic
956867378 3:73383613-73383635 GAGGAAGCAGCACCTGGTGAAGG - Exonic
957738530 3:84233119-84233141 CAGGAAAGAGAACATGTTCTGGG + Intergenic
958889117 3:99763721-99763743 CAGGAAGCAGAACATGGTACTGG - Intronic
959611944 3:108305179-108305201 TAGAAAACAGAACCTGAGCAAGG + Intronic
961662647 3:128477880-128477902 CATCAGACACAACCTGGTCAGGG + Intergenic
961796502 3:129412651-129412673 CAAGAGACAGAAGGTGGTCAGGG - Intronic
962182262 3:133220430-133220452 CAAGAAACATAAGCTGGGCATGG - Intronic
962608316 3:137050868-137050890 GAGGAAAAAGAACCTGGGCTGGG - Intergenic
963452469 3:145501168-145501190 CAGGTAACACAACCTGTTCCTGG - Intergenic
963643673 3:147887189-147887211 CAAGAAACAGACTCTTGTCAAGG - Intergenic
964171550 3:153776051-153776073 CAAGATACAGAACATTGTCATGG + Intergenic
965641051 3:170829351-170829373 CAAAAAAGAGAACCTTGTCAGGG - Intronic
969252108 4:5974721-5974743 CAGGACACAGAATTTGGTCAAGG - Intronic
969610896 4:8227367-8227389 GAGGAAGCAGAGCCTGGCCAGGG - Exonic
969692308 4:8710437-8710459 CAGGAAGCAGAACCTGAACTGGG + Intergenic
970535974 4:17030094-17030116 CAGGCAACAGAACATGTGCAGGG + Intergenic
972602301 4:40583414-40583436 AGGGAAACAGAAGCTGGACAAGG + Intronic
973311824 4:48717748-48717770 CAGGAAATAGAGACTGGTCTGGG - Intronic
973372350 4:49261935-49261957 CAGGCAACAACACCTGGGCACGG + Intergenic
973388650 4:49533203-49533225 CAGGCAACAACACCTGGGCACGG - Intergenic
975940927 4:79644637-79644659 CAGGAAATAAAATCTGGTAAAGG + Intergenic
976500225 4:85779392-85779414 CAGACAAGAGAACCTGGGCAGGG + Intronic
977073100 4:92417897-92417919 CAGGCAACAGAGCCTGCACAGGG - Intronic
977155509 4:93568109-93568131 GAGGAAACAGAACCTGGAGGAGG - Intronic
978871766 4:113586860-113586882 CAGGTAAAAGAACAGGGTCATGG + Intronic
979216636 4:118172122-118172144 CAGTAAAGTGAACATGGTCAAGG + Intronic
980136538 4:128863568-128863590 CAGGAATCCTAACCTGGTCTGGG - Intronic
980545918 4:134261118-134261140 CAGGCAAGAGAACCTGTGCAGGG + Intergenic
981196034 4:141921783-141921805 CAGTAAACAGAAACAGGGCAGGG - Intergenic
983099839 4:163611758-163611780 AAGGACACAGAAACAGGTCAGGG - Intronic
983789776 4:171782547-171782569 CAGGAAACAGAGCTTGTTTAGGG + Intergenic
984250356 4:177325003-177325025 CTGGAAACAGAAAATGGTCTTGG - Intronic
984507787 4:180641228-180641250 CAGGAAAAACAGACTGGTCAAGG - Intergenic
986830670 5:11573729-11573751 CAGGAATCAGAACTTGGAAATGG + Intronic
988793467 5:34630776-34630798 CAGGCAATAGAACTTGGGCAGGG - Intergenic
990953032 5:61317267-61317289 CAGGCAAAACTACCTGGTCATGG + Intergenic
991772557 5:70053350-70053372 CAGGAAACAGCACTTGGGGATGG + Intronic
991851850 5:70928774-70928796 CAGGAAACAGCACTTGGGGATGG + Intronic
994357966 5:98816293-98816315 CAGGAAAGAGAACATGTGCAGGG - Intergenic
995075076 5:107973126-107973148 CAGGAAATGGAGCCTGTTCAGGG + Intronic
996332411 5:122345121-122345143 CAAGAATCACATCCTGGTCATGG + Intronic
997109195 5:131056172-131056194 CAGGCAAGAGAACATGTTCAGGG + Intergenic
997434979 5:133867485-133867507 GAGGAAACAGAATCGGCTCATGG - Intergenic
998613398 5:143713647-143713669 CAGGAATCAGAAAGTTGTCAAGG + Intergenic
999421600 5:151449046-151449068 AAACAAACAGACCCTGGTCAGGG - Intronic
1001245635 5:170104343-170104365 CTGCTACCAGAACCTGGTCAGGG + Intergenic
1001601482 5:172931805-172931827 CAGGGAAAAGAACCAAGTCATGG - Intronic
1002108074 5:176890006-176890028 CAGGAAACTCATCCTGGTCCTGG - Intronic
1003244114 6:4369835-4369857 CAGGAAATAGAAACTGCTCTAGG + Intergenic
1003258756 6:4496951-4496973 CAGGAAATAGAGCGTGGACAGGG + Intergenic
1003343013 6:5239891-5239913 TAGGGAACAGTACCTGGCCATGG + Intronic
1004469934 6:15920260-15920282 CAGGAGACAGGACATGGACATGG + Intergenic
1005840722 6:29743201-29743223 CAGGAACCAGCTCCTTGTCAGGG - Intergenic
1006341665 6:33450669-33450691 CAGGAACCAGGAGTTGGTCAAGG + Intronic
1006837478 6:37007690-37007712 GAGGAAACAGAAGCTGGCCAGGG + Intronic
1007635370 6:43296812-43296834 CAGGCAGCAGAAGCTGGTGAAGG + Intronic
1007756650 6:44103849-44103871 CAGGAGGCAGAAACTGCTCATGG + Intergenic
1007950872 6:45871198-45871220 CAGGACACAGAACCTGCTGGAGG + Intergenic
1008471714 6:51891935-51891957 CAGCAGCCAGGACCTGGTCAGGG + Intronic
1008523451 6:52384314-52384336 CAGTACACAGTACCTGGTGAGGG + Intronic
1010480591 6:76348102-76348124 CAGGCAACAAAACTTGTTCAGGG - Intergenic
1012245361 6:96920173-96920195 CAGGGAAAGGGACCTGGTCAAGG + Intergenic
1012478818 6:99645191-99645213 CAGGAAAGAGAACGTGTGCAGGG + Intergenic
1013411790 6:109889726-109889748 CAGCAAACAGGCCCTCGTCAGGG + Intergenic
1014320826 6:119925984-119926006 CAGGGAACAGAAAGAGGTCAAGG - Intergenic
1016120421 6:140336896-140336918 CAGGAAATAGAGACTGGTCAAGG - Intergenic
1016151640 6:140748383-140748405 CAGGCAACAGAGCCTGTGCAGGG - Intergenic
1016825889 6:148388208-148388230 CTGAAAACAGAACCTGGGCCGGG - Intronic
1017118888 6:151005333-151005355 AAGGAAACAGAACATGGAAAAGG - Intronic
1018572499 6:165225746-165225768 CAGGACAAAGATCCTGCTCAGGG + Intergenic
1018684599 6:166294242-166294264 CAGGAAACACCATCGGGTCAGGG - Intergenic
1018971513 6:168532594-168532616 CAGGAACCAGCTCTTGGTCAGGG - Intronic
1019939955 7:4282017-4282039 CAGGTAAGAGACCATGGTCATGG + Intergenic
1020230666 7:6316018-6316040 CAGATAACAAAACCTGGGCAAGG + Intergenic
1021639702 7:22725586-22725608 CAGGAAAGAGAACTTGGTTCAGG + Intergenic
1021909044 7:25365823-25365845 CAGAAAACAGAAGCTGTTCTTGG - Intergenic
1023489309 7:40721009-40721031 GAGGAAACAGAGTCTGGTCATGG + Intronic
1023508924 7:40929570-40929592 CAGGAAACAGATGCTGGAAAGGG - Intergenic
1024483707 7:49892565-49892587 CAAGAAACAGAACATGACCAGGG - Intronic
1024563853 7:50665724-50665746 GAGGAAGCAGAGCCTGGGCAGGG + Intronic
1024812170 7:53224972-53224994 CAGGTAACAGATCCTGCACAGGG + Intergenic
1026747961 7:73027432-73027454 CAGGAAGGAGAACCTGGGGAGGG - Intergenic
1026751609 7:73055571-73055593 CAGGAAGGAGAACCTGGGGAGGG - Intergenic
1026755258 7:73083686-73083708 CAGGAAGGAGAACCTGGGGAGGG - Intergenic
1026758908 7:73111718-73111740 CAGGAAGGAGAACCTGGGGAGGG - Intergenic
1026832876 7:73621187-73621209 GAGCAAACAGGACCTGGTTAGGG - Intronic
1026895902 7:74009991-74010013 CAGGAGACAGAACCAGGGCATGG + Intergenic
1027034165 7:74912722-74912744 CAGGAAGGAGAACCTGGGGAGGG - Intergenic
1027088498 7:75281767-75281789 CAGGAAGGAGAACCTGGGGAGGG + Intergenic
1027092141 7:75309695-75309717 CAGGAAGGAGAACCTGGGGAGGG + Intergenic
1027095784 7:75337662-75337684 CAGGAAGGAGAACCTGGGGAGGG + Intergenic
1027323556 7:77030032-77030054 CAGGAAGGAGAACCTGGGGAGGG - Intergenic
1028256381 7:88603487-88603509 CAGGAGACAGTAACTGGACAGGG - Intergenic
1029014070 7:97295986-97296008 GAGGAAACAAAAACTAGTCAGGG - Intergenic
1029395884 7:100308379-100308401 CAGGAAGGAGAACCTGGGGAGGG + Intronic
1029396106 7:100309765-100309787 CAGGAAGGAGAACCTGGGGAGGG + Intronic
1029396331 7:100311155-100311177 CAGGAAGGAGAACCTGGGGAGGG + Intronic
1029396556 7:100312545-100312567 CAGGAAGGAGAACCTGGGGAGGG + Intronic
1029396781 7:100313938-100313960 CAGGAAGGAGAACCTGGGGAGGG + Intronic
1029856122 7:103518624-103518646 CAGGAAACACATGCTGGGCATGG - Intronic
1034693374 7:153032008-153032030 CAAGTAACAGAAGCTGGTCCTGG + Intergenic
1034782443 7:153892958-153892980 CAGGAAACAGTAGCTAGGCATGG + Intronic
1035422979 7:158744652-158744674 CAGGAAAAAGAGGCTGGGCATGG - Intronic
1036776477 8:11616350-11616372 CAGAGAACAGAACCTGCTCGCGG + Intergenic
1039547435 8:38420244-38420266 CAGGCCACAGTACCTGGTGATGG + Intronic
1039942674 8:42104540-42104562 GTGGAAACAGACCCTGGTCCTGG - Intergenic
1040481796 8:47833499-47833521 CAGGCACCAGGACCTGGTCTTGG - Intronic
1041429905 8:57767617-57767639 CAGGAAACATAAAATGGGCATGG + Intergenic
1041539269 8:58964477-58964499 CTGGAACCAGCTCCTGGTCAGGG - Intronic
1041684870 8:60634268-60634290 CAGGAAACAGAACATTCTCGTGG - Intergenic
1042220310 8:66466914-66466936 CAGGAAACAGAGCCAGATCGGGG + Intronic
1042324244 8:67512235-67512257 CAGGAAAAAGAAAGTGGTAAGGG - Intronic
1043587039 8:81781546-81781568 CAGGAAACAGATCCTGCCCTAGG - Intergenic
1044130216 8:88513195-88513217 CAGGAAAGAGAACTTGTGCAGGG - Intergenic
1045304311 8:100944741-100944763 CAGGACACAGAAGGTAGTCAAGG + Intronic
1047223560 8:122938221-122938243 CAGGAAACATAAACTGGGCATGG - Intronic
1047468118 8:125139564-125139586 CAGGTAAGAGAACCTGTGCAGGG + Intronic
1047864019 8:129001705-129001727 GTGGAAACAGATACTGGTCACGG + Intergenic
1048274612 8:133056925-133056947 CACGAATCAGAACCTGGGGATGG - Intronic
1049642929 8:143723501-143723523 CAGGAAACAGCCCCTGGGCTGGG - Intergenic
1051466174 9:17380475-17380497 AAGGACACAGGTCCTGGTCAAGG - Intronic
1052231314 9:26157507-26157529 CAGGAAAGAGAACGTGTGCAGGG - Intergenic
1054160449 9:61669157-61669179 CAGGATACAGAACCGTGCCACGG + Intergenic
1054352537 9:64030167-64030189 CAGGCAACAACACCTGGGCACGG - Intergenic
1055055441 9:72019379-72019401 CAGAAAACAGAACCTACACAGGG - Intergenic
1058486064 9:105444567-105444589 GAGGATACAGAACCTGGTTCTGG + Intergenic
1058792333 9:108462180-108462202 CAGTAAACTGATCATGGTCAAGG + Intergenic
1062064821 9:134520916-134520938 CAGGACACAGACCCTGGAGATGG + Intergenic
1062318484 9:135979353-135979375 CAGGAAACAGGACCGGGTTGGGG + Intergenic
1062414902 9:136443392-136443414 CAGAAAAGAGAAGCTGGGCACGG + Intronic
1203553152 Un_KI270743v1:181061-181083 CAGGCAACAACACCTGGGCACGG - Intergenic
1186090901 X:6047985-6048007 AAGGAAAAACAGCCTGGTCATGG + Intronic
1187047168 X:15658399-15658421 CTGGAAGGAGAACCTGGGCATGG - Intronic
1187698763 X:21945142-21945164 CAGGATACAGACCCTGGTGGAGG - Intronic
1188304583 X:28546862-28546884 CAGGAAACAGATGATGGTGATGG - Intergenic
1188981493 X:36730993-36731015 GAGGAAAGAGAATCTGGTCAAGG - Intergenic
1196106374 X:111900445-111900467 CAGGAAAAACAATCTGGTGAAGG + Intronic
1196714495 X:118798604-118798626 CAGGAAACAGAAGCTGGAAGTGG - Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic