ID: 1173226308

View in Genome Browser
Species Human (GRCh38)
Location 20:41164195-41164217
Sequence CCTCAGAGTGAGTCGGAGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173226302_1173226308 1 Left 1173226302 20:41164171-41164193 CCATCAAGGAGCATGCCTTTGTG 0: 1
1: 0
2: 2
3: 21
4: 173
Right 1173226308 20:41164195-41164217 CCTCAGAGTGAGTCGGAGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 167
1173226301_1173226308 9 Left 1173226301 20:41164163-41164185 CCTGCACACCATCAAGGAGCATG 0: 1
1: 0
2: 2
3: 15
4: 155
Right 1173226308 20:41164195-41164217 CCTCAGAGTGAGTCGGAGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173226308 Original CRISPR CCTCAGAGTGAGTCGGAGGC TGG Exonic
900099304 1:954356-954378 TCTGAGAGGGAGTTGGAGGCTGG - Intronic
901156561 1:7143578-7143600 CCTCAGTGTTAGTTGGAGGTTGG - Intronic
901233450 1:7654024-7654046 CCTGAGAATGAGCCAGAGGCGGG + Intronic
901377241 1:8848160-8848182 CTTCCCAGTGAGGCGGAGGCAGG + Intergenic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902034354 1:13446079-13446101 GCACAGTGGGAGTCGGAGGCAGG + Intergenic
902281037 1:15374667-15374689 CCCCAAAGTGAGCCGGAGTCTGG - Intronic
902449116 1:16485451-16485473 CCTGAGTGTGAGTGGGATGCTGG + Intergenic
902468508 1:16632157-16632179 CCTGAGTGTGAGTGGGATGCTGG + Intergenic
902505628 1:16937833-16937855 CCTGAGTGTGAGTGGGACGCTGG - Intronic
902859878 1:19237508-19237530 CCACAAAGTGAGCAGGAGGCCGG + Intronic
904475581 1:30762593-30762615 GCTCAGAGTGAGGCAGAGGCTGG - Intergenic
915142684 1:153776957-153776979 CCACAGAAAGAGGCGGAGGCAGG - Intronic
915897807 1:159825082-159825104 ACTCAGCGTGAGTCTGTGGCTGG - Intergenic
916212870 1:162372879-162372901 CCACAGAGTGGGAGGGAGGCTGG - Intronic
916255361 1:162781769-162781791 CCTCAGATTTAGTGGGAAGCTGG + Exonic
918607943 1:186452154-186452176 CCCCAGAGTGAGTTGGTGACAGG - Intronic
1067527030 10:47045250-47045272 CCTCAGAGTGAGGAGGAGACTGG + Intergenic
1068818538 10:61346020-61346042 ACTCCGAGTGTTTCGGAGGCTGG + Intergenic
1070586532 10:77770982-77771004 CCTCAGAGAGACTCAGCGGCAGG - Intergenic
1070602256 10:77873979-77874001 CCTCAGTGTGAGCTGGAGGAGGG - Intronic
1073458193 10:103650322-103650344 CATCATAGTGAGTTTGAGGCAGG - Intronic
1074438953 10:113458355-113458377 CCTCAGAGTGCTTGGGAGGTAGG + Intergenic
1075713908 10:124544994-124545016 CCTCAGAGTGGGGCAGAGACAGG - Intronic
1076500254 10:130931043-130931065 CCTCAGGGAGAGTGGGAGCCTGG + Intergenic
1077518305 11:3015765-3015787 CCTCAGTGTGAGTAGCATGCAGG - Exonic
1078748403 11:14137269-14137291 CCTAAGAGGGATTCTGAGGCTGG - Intronic
1081778821 11:45695721-45695743 CATCACAGTGACTCTGAGGCAGG + Intergenic
1083199103 11:61109018-61109040 CCTAGGAGTGAGCCAGAGGCAGG + Intronic
1084122709 11:67078507-67078529 CCTCAGGGTGAGGAGGAGGGTGG + Intergenic
1084443152 11:69187445-69187467 CCTCAGACTGAGCCTGAGCCAGG - Intergenic
1084740946 11:71139229-71139251 CCTCAGGGAGAGGCGGATGCGGG + Intronic
1087045973 11:93844302-93844324 TCCCAGAGTGAGTCTGGGGCAGG + Intronic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1089213256 11:116820354-116820376 CCTCAGTGTGAGGCAGAGTCGGG + Intergenic
1091401425 12:182773-182795 CCTCAGAGGGAATGGAAGGCAGG + Intergenic
1096514074 12:52146767-52146789 ACCCAGAGTGAGGCCGAGGCAGG - Intergenic
1096665790 12:53163258-53163280 CCACAGTGGGAGTCTGAGGCAGG + Intronic
1099359884 12:81687078-81687100 CCTCCAAGTGAGTCTGATGCAGG + Intronic
1102530707 12:113544441-113544463 TCTCACAGTGAGTCTGTGGCTGG + Intergenic
1103670913 12:122614399-122614421 CCTCTGAGTCAGTTGGAGGCTGG + Intronic
1103940937 12:124500815-124500837 CCTCAGGGTGAGGGGCAGGCGGG + Intronic
1108029233 13:46211793-46211815 CCCCACAGTGCGTCGGAGGAAGG + Intronic
1110233525 13:73192253-73192275 CCGGAGAGTGAGAAGGAGGCAGG - Intergenic
1115503562 14:34071713-34071735 CCTCAGGCTGAGTCACAGGCAGG - Intronic
1115994444 14:39181197-39181219 CCTCAGGCTGAGAGGGAGGCTGG - Exonic
1117800848 14:59443260-59443282 TCTGAGAGTGAGGAGGAGGCAGG - Intronic
1118731746 14:68671568-68671590 CCCCAGAGGTTGTCGGAGGCGGG - Intronic
1119172691 14:72546907-72546929 CCTGAGAGTGGGTGGGAGGAAGG - Intronic
1119552092 14:75522510-75522532 CCCCAGAGTGAGGAGGACGCAGG + Exonic
1120665820 14:87305468-87305490 CCTAAGAGTGACTTCGAGGCAGG - Intergenic
1123141314 14:106081883-106081905 CCTTAGACTGAGTCTGAGGGAGG - Intergenic
1123166481 14:106330104-106330126 CCTTAGACTGAGTCTGAGGGAGG - Intergenic
1123169162 14:106355140-106355162 CCTTAGACTGAGTCTGAGGGAGG - Intergenic
1124597703 15:31104200-31104222 CCTCAGAGGGAATAAGAGGCCGG + Intronic
1129329490 15:74819826-74819848 CCTCACACTCAGTCAGAGGCAGG - Intronic
1129948513 15:79563164-79563186 AGTCAGAGTGAGTCGGATGCTGG + Intergenic
1130631141 15:85570152-85570174 ATTCAGAGTGAGTAGGAGGCCGG + Intronic
1130857544 15:87854269-87854291 ACTCAGAGTGAGACAGAGGGGGG + Intergenic
1132870294 16:2112768-2112790 CCTGTGAGTGACTCGGGGGCCGG - Exonic
1133089269 16:3390716-3390738 CCTCAGACTCATTCGGAGGTGGG - Intronic
1133329433 16:4962979-4963001 CCTCAGATTGGGTCAGATGCCGG + Intronic
1133729859 16:8569787-8569809 GCTCAGCCTGAGACGGAGGCAGG - Exonic
1133769260 16:8858334-8858356 TCTCTGAGTGAGTCAGCGGCAGG - Exonic
1134659738 16:15975083-15975105 CTTAAGAGTGAGGGGGAGGCTGG - Intronic
1134717129 16:16362820-16362842 CCTGTGAGTGACTCGGGGGCCGG + Intergenic
1134957623 16:18389339-18389361 CCTGTGAGTGACTCGGGGGCCGG - Intergenic
1136069869 16:27781266-27781288 CCTCTGTGAGAGTGGGAGGCCGG + Intergenic
1136995572 16:35186387-35186409 CCTCAGGGTGAAGCAGAGGCTGG + Intergenic
1138088528 16:54155413-54155435 CCTGCGAGTGACTCTGAGGCAGG + Intergenic
1139281335 16:65773480-65773502 CTTCAGGGTGAGACAGAGGCAGG - Intergenic
1139429568 16:66903973-66903995 CCTCAGTCTGAGGCTGAGGCTGG - Intergenic
1139517027 16:67458242-67458264 CCTCAGAGAGAGCAGGAAGCTGG - Intronic
1139611999 16:68065845-68065867 CCTCAGAATGATTCTGAGGACGG + Intronic
1141266814 16:82505391-82505413 CCTGAGAGTGAATGAGAGGCTGG + Intergenic
1142309580 16:89304782-89304804 CCTAAAAGTGAGCAGGAGGCAGG - Intronic
1142418791 16:89957733-89957755 CCTGAGAGAGAGCCAGAGGCTGG - Intronic
1143824958 17:9597976-9597998 CTTCAGAGTGAGACGGAGCCAGG + Intronic
1145962969 17:28897970-28897992 TCTCACAGTGAGTAGGAGGAGGG - Exonic
1146448444 17:32952160-32952182 GCTCAGAGAAAGTGGGAGGCAGG - Intergenic
1146591189 17:34129302-34129324 CCTCAGAGTGAGGCAGAGTGGGG - Intronic
1147757843 17:42780406-42780428 CCTCAGAGTGAGACTGCGGCCGG + Intergenic
1147992626 17:44344362-44344384 CCCCAGAGTGAGTTGAAGGATGG - Intergenic
1151523023 17:74644631-74644653 CCTCAAAGTCAGTCAGAGCCTGG + Intergenic
1152843915 17:82587676-82587698 TCTCAGAGTCCGTCCGAGGCCGG + Intronic
1156458683 18:37309029-37309051 CCTCAGAGAGGGTCTGAGGCTGG - Intronic
1156480539 18:37433721-37433743 TCTGAGAGTGAGTCTGAGGATGG + Intronic
1161100179 19:2417833-2417855 CCACAGAGTGAGGAGGAGGTGGG - Intronic
1161303166 19:3552884-3552906 CCCTAGAGTGAGTCGGAGCCAGG + Intronic
1162217727 19:9150166-9150188 ACTCAGAGTGAGTGGCAGCCAGG - Intronic
1162600034 19:11661861-11661883 CCCCAGAGGGAGGCTGAGGCGGG - Intergenic
1163127735 19:15253397-15253419 CCTCAGTGGGAGGTGGAGGCAGG - Intronic
1164501003 19:28820321-28820343 CCTCACAGGGAGGCTGAGGCTGG + Intergenic
1165097826 19:33419339-33419361 CCTCAGACTGAGTGGGCAGCAGG - Intronic
1166198293 19:41220480-41220502 CCTCAGAGTGGGGTGGAGGGCGG - Intronic
1166861606 19:45814861-45814883 CATCAGAGTAAGGCTGAGGCTGG + Exonic
1167466115 19:49651800-49651822 CCCCAGCGCGAGTCGGCGGCGGG - Exonic
1202632916 1_KI270706v1_random:16480-16502 CCTCAAAGTTAGTGGGAGCCAGG - Intergenic
926841151 2:17081824-17081846 CCTCAGAGTGAGGAGAAGGCAGG + Intergenic
928335974 2:30398527-30398549 CCTCAGAGGCAGTCTAAGGCAGG + Intergenic
934900503 2:98156026-98156048 CCTCAGAATGAGTCTGGGGTGGG + Intronic
937513912 2:122630756-122630778 GATCAGTGTGAGTTGGAGGCAGG - Intergenic
937944410 2:127319262-127319284 CCTGAGAGAGAGGCTGAGGCTGG + Intronic
945169174 2:206978204-206978226 CCTCAGAGTGGGGAAGAGGCTGG + Intergenic
946372539 2:219289780-219289802 CCCAAGTGTGAGTCAGAGGCAGG + Exonic
948206390 2:236164690-236164712 CCTCAGTCGGAGGCGGAGGCTGG - Intergenic
1168935284 20:1659818-1659840 CCTCATAGTGAGGCTGGGGCAGG + Intergenic
1169405930 20:5321254-5321276 CCTCAGAGAGAGGCGGTGGTGGG + Intergenic
1172170866 20:32931114-32931136 CCGCAGAGTGAGTTGGGGTCTGG + Intronic
1172905513 20:38366390-38366412 CCTCACAGTGACTCGAAGGTGGG + Intronic
1173226308 20:41164195-41164217 CCTCAGAGTGAGTCGGAGGCTGG + Exonic
1173336138 20:42113695-42113717 CCTAAGAGAGAGTGGGAAGCAGG - Intronic
1173791799 20:45832893-45832915 CCTCTGAGGGAGGCAGAGGCAGG + Intronic
1173848577 20:46203241-46203263 CCAGAGAGTGAGTGGGAGGGAGG + Intronic
1175834237 20:61983036-61983058 GCTCTGAGTGAGGCGGAGGCGGG + Intronic
1176130921 20:63496543-63496565 CCTCAGAGGGATGGGGAGGCTGG - Intronic
1176254505 20:64144611-64144633 CCTCAGACTGAGTCTGATGGGGG + Intergenic
1176645139 21:9342360-9342382 CCTCAAAGTTAGTGGGAGCCAGG - Intergenic
1177344627 21:19853800-19853822 ACTCACAGTGAGTAGCAGGCAGG + Intergenic
1177622982 21:23620767-23620789 CATCAGAGTCAGTCAGAGGCAGG + Intergenic
1180367815 22:11956874-11956896 CCTCAAAGTTAGTGGGAGCCAGG + Intergenic
1182619291 22:31609985-31610007 CCTTAGAGGGAGGCGGTGGCAGG + Intronic
1184877073 22:47282728-47282750 CCCCAGAGTAAGCTGGAGGCTGG - Intergenic
949355964 3:3180745-3180767 CCACAGACTGATTCGGAGACAGG - Intergenic
950541516 3:13616040-13616062 CATCAGGGTGAGGCAGAGGCAGG + Intronic
950647241 3:14384421-14384443 CCTGGGAGTGGGTCAGAGGCAGG - Intergenic
950671992 3:14532742-14532764 GCGCAGACTGAGTCGGAGGTGGG + Intronic
951016973 3:17742362-17742384 CCTGAGGCTGAGTGGGAGGCCGG + Intronic
953382843 3:42487023-42487045 TCCCAGAGTGAGTGGGAAGCTGG - Intergenic
953472624 3:43179890-43179912 GCTAAGTGTGAGTTGGAGGCAGG - Intergenic
1202741753 3_GL000221v1_random:62708-62730 CCTCAAAGTTAGTGGGAGCCAGG + Intergenic
968697625 4:2040842-2040864 CCTAAGAGTGGGTGGGAGGGTGG - Intronic
969664038 4:8546859-8546881 CCACACACGGAGTCGGAGGCAGG + Intergenic
970206413 4:13659749-13659771 CCTCACGGTGAGGAGGAGGCAGG - Intergenic
971738919 4:30495862-30495884 CCTGAGAGTTGGTGGGAGGCAGG - Intergenic
971996499 4:33972325-33972347 CCTCAGAATGAGTCTGGGGAAGG + Intergenic
976199180 4:82562059-82562081 CCCCAGAATAAGTCGGGGGCGGG - Intronic
976793626 4:88908234-88908256 TCTCACAGTGAGTCAGAAGCGGG - Intronic
977172631 4:93781534-93781556 CCTCAGTGTCAGTCGGGGGTTGG + Intergenic
979624128 4:122827077-122827099 CCCCGGAGCGGGTCGGAGGCCGG + Exonic
982173295 4:152682224-152682246 CCTCAGAGTGAGTGGCACACAGG + Intergenic
984766604 4:183404904-183404926 GCTTAGAGTGAGTAGGAGGGAGG + Intergenic
987063081 5:14261273-14261295 ACTCACAGTGAGTCCCAGGCAGG + Intronic
989099396 5:37810303-37810325 CCTCAGAGAGAGCCGCAGGTGGG - Intergenic
998882191 5:146655610-146655632 GCTCACAGTGAGTCTGAGGCAGG + Intronic
999244016 5:150143872-150143894 CCTTAGAGTGATCCCGAGGCTGG - Intronic
1002344432 5:178537517-178537539 CCTCAGAGGGAGTCTGTGGCAGG + Intronic
1002496444 5:179616010-179616032 ACTTAGAGTAAGTCGCAGGCAGG - Intronic
1006047181 6:31308085-31308107 CCCCAGGGTGAGCCGGAGGCGGG + Intronic
1006294597 6:33164522-33164544 CCTCAGAGGGAGACAGAGACGGG + Intronic
1007423859 6:41734895-41734917 CCTGAGAGGGGGTCGGAGGTAGG - Intronic
1008572880 6:52831991-52832013 CCTCAGAGTGAAGCCAAGGCCGG + Intronic
1011677085 6:89745104-89745126 ACTAAGAGTGGGTCGGGGGCTGG - Intronic
1016735629 6:147476723-147476745 CCTCAGAGACAGTAGGAGGAAGG - Intergenic
1018294469 6:162330895-162330917 CCACTGAGTGGGTGGGAGGCAGG + Intronic
1018416760 6:163608278-163608300 TCTCAGAGTGACGCAGAGGCTGG - Intergenic
1022216289 7:28265539-28265561 CCTGAGGGTGATTCTGAGGCAGG - Intergenic
1026525496 7:71149969-71149991 CCTGAAAGTGTGTCGGGGGCTGG + Intronic
1030659782 7:112206668-112206690 CCGCAGGGCGGGTCGGAGGCGGG - Exonic
1033620740 7:143060171-143060193 TCTAACAGTGAGTCAGAGGCTGG + Intergenic
1033641743 7:143268361-143268383 CCTCAGTGGGAGGCTGAGGCAGG + Intronic
1035313395 7:157983603-157983625 CCTGGGAGTGAGTCTGAGGCAGG + Intronic
1037809236 8:22076826-22076848 CCCCAGAATGTGTGGGAGGCTGG + Intronic
1041896214 8:62927180-62927202 CATGAGAGTGAGTGGGAGGGGGG - Intronic
1042520476 8:69706459-69706481 CCCCAGAGTGATTAGGAGGTGGG + Intronic
1048289961 8:133173668-133173690 CCTCAGTGTTAGTGGGAGCCTGG - Intergenic
1049390161 8:142363614-142363636 CCTCAGGGTGAGTGGCAGGCTGG - Intronic
1053280208 9:36815706-36815728 TCACAGAGTGAGCCAGAGGCAGG - Intergenic
1053462766 9:38283160-38283182 CCACAGAGAGAGTCAGCGGCAGG - Intergenic
1057311344 9:93945138-93945160 CCTCAGAGTCAGGAGGATGCTGG - Intergenic
1057736630 9:97668314-97668336 CTTCAGAGTGAGCTGGGGGCAGG + Intronic
1057851936 9:98572668-98572690 CCTGAGAGTGAGAAGGAGGCAGG + Intronic
1061301793 9:129709774-129709796 CCTCCGAGTGAGGAAGAGGCTGG - Intronic
1062076392 9:134592297-134592319 CCGCAGAGAGAGGCCGAGGCTGG - Intergenic
1203710382 Un_KI270742v1:92632-92654 CCTCAAAGTTAGTGGGAGCCAGG + Intergenic
1186512658 X:10142190-10142212 GCTCAGCGTGAGTCTGAAGCAGG + Exonic
1190652827 X:52583290-52583312 CCTCAGAGTGGGTTGGGGGGTGG + Intergenic
1192174916 X:68879499-68879521 CCTGAGAGCTAGTTGGAGGCTGG - Intergenic