ID: 1173226868

View in Genome Browser
Species Human (GRCh38)
Location 20:41167263-41167285
Sequence CACAGGAGGTGAGACCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 480}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173226861_1173226868 7 Left 1173226861 20:41167233-41167255 CCGCCTGGTGGATGGTATGGAGG 0: 1
1: 0
2: 1
3: 11
4: 129
Right 1173226868 20:41167263-41167285 CACAGGAGGTGAGACCAGTGAGG 0: 1
1: 0
2: 2
3: 37
4: 480
1173226854_1173226868 29 Left 1173226854 20:41167211-41167233 CCCAAGAGTGGTTGTGGAGCCTC 0: 1
1: 0
2: 2
3: 9
4: 93
Right 1173226868 20:41167263-41167285 CACAGGAGGTGAGACCAGTGAGG 0: 1
1: 0
2: 2
3: 37
4: 480
1173226859_1173226868 10 Left 1173226859 20:41167230-41167252 CCTCCGCCTGGTGGATGGTATGG 0: 1
1: 0
2: 1
3: 7
4: 74
Right 1173226868 20:41167263-41167285 CACAGGAGGTGAGACCAGTGAGG 0: 1
1: 0
2: 2
3: 37
4: 480
1173226864_1173226868 4 Left 1173226864 20:41167236-41167258 CCTGGTGGATGGTATGGAGGGCA 0: 1
1: 0
2: 0
3: 13
4: 174
Right 1173226868 20:41167263-41167285 CACAGGAGGTGAGACCAGTGAGG 0: 1
1: 0
2: 2
3: 37
4: 480
1173226855_1173226868 28 Left 1173226855 20:41167212-41167234 CCAAGAGTGGTTGTGGAGCCTCC 0: 1
1: 0
2: 2
3: 12
4: 137
Right 1173226868 20:41167263-41167285 CACAGGAGGTGAGACCAGTGAGG 0: 1
1: 0
2: 2
3: 37
4: 480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173226868 Original CRISPR CACAGGAGGTGAGACCAGTG AGG Intronic
900087469 1:905191-905213 CACAGGCGGGGACAGCAGTGAGG - Intergenic
900241548 1:1619770-1619792 CACAAGAAGTGAGGCCAGGGAGG + Intronic
901487411 1:9574299-9574321 CCCAGGAGTTGAGACCAGCCTGG - Intronic
903567064 1:24275590-24275612 CACAGGTGGAGAGACCAGAAGGG - Intergenic
903801680 1:25973535-25973557 GAAAGGAGGTGAGGCCAGTTGGG - Intronic
903856179 1:26338619-26338641 CAGAGGAAGGGAGACCAATGTGG - Intronic
903870839 1:26433437-26433459 CTCAGGAGTTGAGACCAGCCTGG + Intronic
904209643 1:28878406-28878428 CCCAGGAGCTGAGACCAGTCTGG + Intergenic
905231750 1:36518779-36518801 ACCAGGCTGTGAGACCAGTGGGG + Intergenic
905232731 1:36525081-36525103 CACAGGAAGGGAGGCCACTGTGG + Intergenic
905740180 1:40363382-40363404 CAGAGGAGTAGGGACCAGTGTGG + Intronic
906146502 1:43563833-43563855 CACTGAAGGAGAGTCCAGTGTGG + Intronic
906432730 1:45768465-45768487 CTCAGGAGTTGAGACCAGCCTGG + Intergenic
906722870 1:48022057-48022079 CACAGGAGATGAGGTCAGAGAGG + Intergenic
908328248 1:63044637-63044659 CAGAGGAGATCAGACCAATGGGG - Intergenic
908887685 1:68808972-68808994 GTCAGGAGCTGAGAGCAGTGAGG + Intergenic
909476424 1:76086048-76086070 CACAAGTGGTGCCACCAGTGAGG - Intronic
910043450 1:82883105-82883127 CAGAGCAGGTGAGACTAGTCAGG - Intergenic
911077448 1:93891271-93891293 GCAAGGAGGTGAGGCCAGTGTGG - Intronic
911428857 1:97757425-97757447 AGCAGGAGGTGAGTCCAGGGAGG + Intronic
912276126 1:108260827-108260849 CCCAGGAGGTAAGACCAGCCTGG + Intergenic
912292102 1:108433531-108433553 CCCAGGAGGTAAGACCAGCCTGG - Intronic
912480807 1:109980998-109981020 CACAGGAGGAGAAGCAAGTGTGG - Intergenic
912719661 1:112009109-112009131 GTCAGGATGTGATACCAGTGTGG - Intergenic
913131681 1:115843231-115843253 CCTAGGAAGAGAGACCAGTGTGG - Exonic
913264103 1:117027616-117027638 GGCAAGAGATGAGACCAGTGAGG + Intronic
914347530 1:146812834-146812856 CTCAGGAGTTGAGACCAGCCTGG - Intergenic
915197157 1:154198080-154198102 GACAGGATGAGTGACCAGTGAGG + Intergenic
915347526 1:155205320-155205342 CCCAGGAGGGGAGATCAGTATGG + Intronic
916095951 1:161350259-161350281 CTCAGGAGTTGAGACCAGCCTGG - Intronic
916149188 1:161769513-161769535 CACAGGAGGTGGGGACAGGGAGG + Intronic
916360234 1:163959692-163959714 CTCATGAAGTGAGACCAGAGTGG + Intergenic
917071214 1:171152743-171152765 GACAGAAGTTGACACCAGTGAGG - Intronic
917321076 1:173781830-173781852 CAGAGGAAGTGAGAGCAGTTTGG + Intronic
917513842 1:175690545-175690567 GACAGGAGGGAAGACCCGTGTGG + Intronic
918069241 1:181122870-181122892 GACTGGAGGTGAGTGCAGTGAGG + Intergenic
918811851 1:189132612-189132634 CACAGGAGGCTATACCAGTGAGG + Intergenic
919388257 1:196948740-196948762 CAGAGGATGTGAAACCAGTGGGG + Intronic
919980326 1:202638844-202638866 CAATGGAAGTGAGACCAGTGGGG + Intronic
920107710 1:203566044-203566066 CAAAGGAGATGAGCACAGTGGGG + Intergenic
920397829 1:205659623-205659645 CACTGGAGGTGCTAGCAGTGAGG - Exonic
921507727 1:215993125-215993147 CACAGTGAGTGAGGCCAGTGAGG - Exonic
922126799 1:222735366-222735388 CCCAGGAGTTGAGACCAGCCTGG + Intergenic
922613041 1:226944097-226944119 CTGAGGAGGTGAGGCCAGAGAGG + Intronic
922651889 1:227347620-227347642 CTCAGGAGCTGAGACCAGCCTGG - Intergenic
923333345 1:232946143-232946165 CACAGGAGGTGAGGTCAGAGGGG - Intergenic
923619396 1:235565653-235565675 CTCAGGAGTTGAGAGCAGTCTGG + Intronic
923737425 1:236624060-236624082 CCCAGGAGTTGAGACCAGCCTGG + Intergenic
923923839 1:238601036-238601058 CCCAGGAGTTGAGACCATGGAGG + Intergenic
924777432 1:247119734-247119756 CGCTGGAGCTGAGTCCAGTGGGG - Intergenic
1063658139 10:8011965-8011987 CCCAGGAGTTGAGACTAGTCTGG + Intronic
1064061096 10:12137794-12137816 GTCAGGAGTTGAGACCAGTCTGG + Intronic
1064413184 10:15126043-15126065 CCCAGGAGGTGGGATCACTGGGG - Intronic
1064539093 10:16387978-16388000 GTCAGGAGTTGAGACCAGTCTGG + Intergenic
1065007391 10:21392605-21392627 CTCAGGAGTTGAGACCAGCCTGG - Intergenic
1065334991 10:24648047-24648069 GTCAGGAGTTGAGACCAGTCTGG - Intronic
1065342030 10:24716548-24716570 CACAGGAGGTGCGCTCAGGGAGG + Intronic
1066125935 10:32343250-32343272 CACAGGCTGTGAGTGCAGTGGGG + Intronic
1066238147 10:33507024-33507046 CACAGAAACTGAGGCCAGTGAGG + Intergenic
1066256478 10:33684341-33684363 CACAGGAGGAGGGGCCAGTTGGG - Intergenic
1066532220 10:36353308-36353330 TGCAGGAGGTGAGTCCAGAGAGG + Intergenic
1067118478 10:43454259-43454281 CTCAGGAGTTGAGACCAGCCTGG - Intronic
1067472309 10:46546077-46546099 CACAGGAGGTAAGATCACAGTGG + Intergenic
1067935836 10:50611584-50611606 CAGAGTAGGTGAGGGCAGTGAGG - Intronic
1069752569 10:70753759-70753781 GAGAGGAGGTGAGACCAAGGGGG - Intronic
1069932095 10:71889733-71889755 TGAAGGAGGTGAGCCCAGTGTGG + Intergenic
1071154930 10:82677260-82677282 CCCAGGAGTTGAGACCAGCCTGG - Intronic
1071577195 10:86737248-86737270 GTCAGGAGTTGAGACCAGCGTGG - Intergenic
1072173414 10:92890796-92890818 AACAGGAAGTGAGGTCAGTGAGG + Intronic
1073270329 10:102257522-102257544 CCCAGGAGTTGAGACCAGCCTGG - Intronic
1074300759 10:112231576-112231598 GACAGGAGGTGAGCCCAGAAAGG + Intergenic
1074354902 10:112773943-112773965 CACAGGAGGTTAGAGCAGAGAGG + Intronic
1075714675 10:124549224-124549246 CACAGGATTTGAGACCAGCCTGG + Intronic
1076107630 10:127835827-127835849 CACTGGAGTAGAGACCTGTGTGG - Intergenic
1076447248 10:130525073-130525095 CATAGGACGTCAGACCCGTGGGG - Intergenic
1076628964 10:131841442-131841464 CACAGGAGGTGACAGCAGAGGGG - Intergenic
1076644785 10:131945667-131945689 CACCTGAGGTCAGACCAGTCTGG - Intronic
1077040983 11:522607-522629 CTCAGGAGTTGAGACCAGCCTGG - Intergenic
1077266173 11:1651688-1651710 CCCAGGATTTCAGACCAGTGTGG - Intergenic
1077357093 11:2123423-2123445 AACAGGAAGGGAGACCAGGGAGG + Intergenic
1080220436 11:29896680-29896702 CACAGGAGGTGAGACCCTTGAGG - Intergenic
1080545321 11:33311388-33311410 CCCAGCAGTTGAGACCAGTCTGG - Intronic
1080824345 11:35835335-35835357 CTCAGGAGTTGAGACCAGCCTGG - Intergenic
1081047637 11:38296311-38296333 CACAGGAGGGGGGACGCGTGGGG + Intergenic
1082029097 11:47592030-47592052 CAGAGGAGGCGAGAACAGTTGGG + Intronic
1082818180 11:57524561-57524583 CCCAGGAGTTGAGACCAGCCTGG - Intergenic
1083555767 11:63625770-63625792 CAGAGGAGTTGAGACCAGCCTGG + Exonic
1084502154 11:69541172-69541194 CACTGGACCTGAGACAAGTGAGG + Intergenic
1085324402 11:75595522-75595544 CAGAGGAGGTGTGTCCTGTGTGG - Intronic
1085865847 11:80290977-80290999 CAGAGGATGTGAGCCCAGTGTGG + Intergenic
1088269141 11:108016123-108016145 CTCAGGAGTGGAGACCAGTCTGG - Intronic
1089116373 11:116098406-116098428 CACAGGAGATGAGGGAAGTGGGG + Intergenic
1089618240 11:119707266-119707288 CCCAGGAGTGGAGCCCAGTGTGG - Intronic
1090845714 11:130528232-130528254 CACAGGGGCTGAGCCCAGGGTGG + Intergenic
1091058829 11:132443221-132443243 AACAGGAGATGAGAGCAGTGAGG + Intronic
1091322094 11:134658843-134658865 GACAGGAGGTGAGAAGCGTGTGG - Intergenic
1091793862 12:3286339-3286361 CTCAGGAGGTGAGGCCTGGGGGG + Exonic
1092145072 12:6209176-6209198 CACCTGAGGTGAGACCAGCCTGG - Intronic
1092732992 12:11551827-11551849 CCCAGGAGTTGAGACCAGCCTGG - Intergenic
1092819169 12:12337058-12337080 GTCAGGAGGTGAGACCAGCCTGG + Intronic
1092940848 12:13405703-13405725 CACAGGTGGGGAGACCATTTAGG - Intergenic
1093703059 12:22244665-22244687 CTGAGGAGTTGAGACCAGTCCGG - Intronic
1093928271 12:24930165-24930187 CACAGGAGGTGAGGACAAGGGGG - Intronic
1094625829 12:32123255-32123277 AATAGTAGGTGAGACCAGAGGGG + Intronic
1096189930 12:49609835-49609857 CCCAGGAGGTAAGATGAGTGGGG - Intronic
1096194464 12:49641010-49641032 CAGAGGAGGTGAGAGCTATGTGG + Exonic
1096728760 12:53588323-53588345 GACAGGATGTGAGACCTGAGTGG + Intronic
1096835071 12:54344962-54344984 CTCAGGAGTTGAGACCAGCCTGG - Intronic
1097188740 12:57209541-57209563 CACAGGAGGAGGAACCGGTGTGG + Intronic
1097879154 12:64671374-64671396 CACAAGAGGCGAGGCCAGGGAGG - Intronic
1101420920 12:104550255-104550277 CACAGGAGGTCAGACCACATGGG - Intronic
1101452281 12:104790372-104790394 TACAGAAGGAGAGAGCAGTGCGG - Intergenic
1102944186 12:116971151-116971173 CCCAGGAGTTGAGACCAGCCTGG + Intronic
1103362278 12:120361482-120361504 CCCAGGAGGGGACACCGGTGGGG - Intronic
1103370160 12:120413465-120413487 CACCTGAGGTGAGACCAGCCTGG + Intergenic
1104902921 12:132198859-132198881 CCCAGGAATTGAGACCAGTCTGG - Intronic
1105941298 13:25150323-25150345 CACAGGAGAAGAGAAGAGTGGGG - Intergenic
1106147545 13:27063641-27063663 CCCAGGAGGTGAGAGCAGCCTGG + Intergenic
1106649140 13:31670358-31670380 CACAGGAGCAGAGACTAGTATGG - Intergenic
1106677516 13:31976635-31976657 CACATGAGGTGACACCATGGTGG - Intergenic
1107004474 13:35592631-35592653 GACAAGAGGTGAGAGTAGTGTGG + Intronic
1107516443 13:41134016-41134038 CACAGGAGGTGAGTCCGAAGCGG - Intergenic
1107569214 13:41638790-41638812 GATAGGAGGTGAGATCTGTGGGG + Intronic
1107602527 13:42028295-42028317 CACAGGAGGTAACACCAGCCAGG + Intergenic
1109687308 13:65838354-65838376 CACTGGAGGTGGGACCTGAGGGG - Intergenic
1110553685 13:76834866-76834888 CCCAGGAGTTGAGACCAGCCTGG + Intergenic
1112469358 13:99673654-99673676 CAATGGAGGTGAGACCAGAGGGG + Intronic
1112597763 13:100824418-100824440 CAAAGGTGGGGAGACCACTGGGG + Intergenic
1114353687 14:21883468-21883490 CACTGGAGGTGAAGCGAGTGAGG - Intergenic
1115655776 14:35442273-35442295 CCCAGGAGTTGAGACCAGCCTGG - Intergenic
1115691511 14:35849063-35849085 CCCAGGAGTTGAGACCAGCCTGG - Intronic
1116654820 14:47638889-47638911 AATAGAAGGTGAGACCAGAGAGG - Intronic
1119775385 14:77244805-77244827 CACAGGAGGAAAGACTTGTGTGG + Intronic
1121038190 14:90724002-90724024 TACAGGATATGAGACCAGTCTGG - Intronic
1121258948 14:92552539-92552561 GGCAGGAGGTGAGAGCAGAGGGG - Intronic
1121864856 14:97353268-97353290 CACAAGAGGTGAGGCAAGTGGGG - Intergenic
1121987699 14:98523868-98523890 CACAAGTGGTGTCACCAGTGAGG + Intergenic
1123508501 15:20971116-20971138 CACAGAAACTGAGACCAGAGAGG + Intergenic
1123565723 15:21544865-21544887 CACAGAAACTGAGACCAGAGAGG + Intergenic
1123601986 15:21982152-21982174 CACAGAAACTGAGACCAGAGAGG + Intergenic
1124065803 15:26342612-26342634 GACAGGAGGTGAGATAAGGGAGG - Intergenic
1124496024 15:30187648-30187670 CAATGGAAGTGAGACCAATGGGG + Intergenic
1124747550 15:32350999-32351021 CAATGGAAGTGAGACCAATGGGG - Intergenic
1125302350 15:38269455-38269477 CTCAGGAGTTGAGACCAGCCCGG - Intronic
1125778685 15:42243379-42243401 CACAGGAAATAAGACCAGTTAGG + Intronic
1126333223 15:47556692-47556714 CACAGCAGGTAAAAGCAGTGAGG - Intronic
1128306683 15:66603571-66603593 CCCTGGAGGTGGGAACAGTGTGG - Intronic
1128443710 15:67738194-67738216 CAGAGGAGGAGAGACCAAAGGGG + Intronic
1128513996 15:68330950-68330972 CCCAGGAGGTGGGAACAGCGGGG + Intronic
1128825264 15:70710045-70710067 CCCAGGAGTTGAGACCAGCCTGG + Intronic
1128870616 15:71152774-71152796 CGCAGCAGGAGAGCCCAGTGAGG - Intronic
1128872041 15:71166453-71166475 CACAGGACCAGAAACCAGTGTGG - Intronic
1129364265 15:75044658-75044680 CAGAGAAGGTGAGAGCACTGGGG - Intronic
1129411184 15:75351205-75351227 CTCAGGACATGAGAACAGTGTGG - Intronic
1129519143 15:76175162-76175184 CAAAGGAGCTGGGGCCAGTGAGG - Intronic
1129848233 15:78777774-78777796 CCCAGGAGGTGAGATGAGAGAGG - Intronic
1129851881 15:78798204-78798226 CACAGGTGGTGTGGGCAGTGGGG - Intronic
1130446732 15:84009069-84009091 CAGAGGCAGGGAGACCAGTGAGG - Intronic
1132090962 15:98947804-98947826 CACAGGTGGGGGGACCAGGGTGG - Intronic
1202974094 15_KI270727v1_random:271958-271980 CACAGAAACTGAGACCAGAGAGG + Intergenic
1133100400 16:3475905-3475927 CATAAGATGTGAGACCAGTCAGG + Intronic
1133473060 16:6094277-6094299 CAAAGGAAGAGAGACCATTGGGG + Intronic
1134056669 16:11174446-11174468 CACATGAGGTGAGGCCAGACAGG - Intronic
1134185612 16:12082882-12082904 CACAGGAGGTGATGGCAGGGTGG - Intronic
1134783716 16:16921953-16921975 CCCAGGAGTTGAGACCAGCCTGG - Intergenic
1136528326 16:30847956-30847978 CTAAGGATGTTAGACCAGTGAGG + Intronic
1136686959 16:32001060-32001082 GTCAGGAGTTGAGACCAGTCTGG + Intergenic
1136787568 16:32944609-32944631 GTCAGGAGTTGAGACCAGTCTGG + Intergenic
1136882211 16:33909177-33909199 GTCAGGAGTTGAGACCAGTCTGG - Intergenic
1137765507 16:50974824-50974846 AGCAGGAAGTGAGACCAATGGGG + Intergenic
1138127844 16:54453442-54453464 CCCAGGAGTTGAGACCAGCCTGG + Intergenic
1139502541 16:67379211-67379233 TCCAGGAGTTGAGACCAGTCTGG + Intronic
1139538641 16:67596795-67596817 GTCAGGAGTTGAGACCAGTCTGG - Intronic
1139688739 16:68625119-68625141 CCCAGGAGTTGAGACCAGTCTGG - Intergenic
1139986456 16:70902396-70902418 CTCAGGAGTTGAGACCAGCCTGG + Intronic
1141139229 16:81486614-81486636 CACAGGAGGTGAGGCTGGAGTGG + Intronic
1141261724 16:82460305-82460327 CACTGGAGGAGAGACCAGAAAGG - Intergenic
1141343658 16:83226477-83226499 CACAGGTGCAAAGACCAGTGTGG - Intronic
1141594014 16:85086614-85086636 CACAGGAGGTGACAGAAGCGGGG - Intronic
1141764064 16:86047094-86047116 CACAGGAGGTGTGAGGGGTGGGG + Intergenic
1203089799 16_KI270728v1_random:1206269-1206291 GTCAGGAGTTGAGACCAGTCTGG + Intergenic
1203118676 16_KI270728v1_random:1515746-1515768 CCCAGGAGTTGAGATCAGTCTGG + Intergenic
1142550406 17:734890-734912 CCCAGGAGTTCAGACCAGCGTGG - Intronic
1142819620 17:2455295-2455317 GTCAGGAGTTGAGACCAGTCTGG - Intronic
1143173730 17:4944905-4944927 CAAAGGAGGTGGGAAGAGTGGGG - Exonic
1144358579 17:14469700-14469722 CACAGGAGGTGCCATCTGTGAGG - Intergenic
1144551774 17:16247147-16247169 CACATGAGGTCATACGAGTGGGG - Intronic
1144686478 17:17229273-17229295 CACAGGCAGTGAGGCCAGAGGGG + Intronic
1144855178 17:18263597-18263619 CACTGCAGGTGAGAAAAGTGAGG + Intronic
1144932080 17:18867924-18867946 CTCAGGAGTTGAGACCAGCCTGG + Intronic
1145796337 17:27657501-27657523 CACCCGAGGTGAGCCCAGGGAGG - Intergenic
1145829314 17:27902511-27902533 CAAAGCAGGTTAGAGCAGTGAGG + Intergenic
1145831452 17:27919765-27919787 CTCAGGAGTTGAGACCAGCTTGG + Intergenic
1146011836 17:29200819-29200841 CTCAGAAGTTGAGACCAGTCTGG + Intergenic
1146071092 17:29682562-29682584 CTCAGGAGTTGAGACCAGCCTGG + Intronic
1146769864 17:35558998-35559020 ATCAGGAGTTGAGACCAGCGTGG + Intergenic
1147118454 17:38320533-38320555 TGCAGGAAGTGAGAGCAGTGTGG + Intronic
1147147923 17:38496741-38496763 GTCAGGAGTTGAGACCAGTCTGG + Intronic
1147452761 17:40516064-40516086 TACAGGAGGTTAGAACAGTAGGG - Intergenic
1148253614 17:46108233-46108255 AACAGGAGATGAGGCCAGAGAGG - Intronic
1148665435 17:49371321-49371343 CTCAGGTGGTGAGGCCAGTTGGG - Intronic
1151446643 17:74170282-74170304 CCCAGGAGTTGAGACCAGCCTGG - Intergenic
1151519955 17:74620831-74620853 CACTGGAGGTGAGACCAGCCTGG + Intronic
1151711398 17:75809045-75809067 CACATGAGGTGACACGACTGGGG + Intronic
1151761780 17:76108222-76108244 CCCAGGAGATGAGACCAGCCTGG - Intronic
1151842191 17:76626578-76626600 CACAGGAGGTGAGAAGGGAGAGG - Intronic
1151920202 17:77148830-77148852 CACAGGAGCTGAGACGTGCGAGG - Intronic
1153572314 18:6485810-6485832 CACTGGAGGTGAGACCATCCTGG - Intergenic
1154213374 18:12398141-12398163 CAGAGGATGGGGGACCAGTGAGG + Intergenic
1154219157 18:12436921-12436943 CCCAGGAGTTGAGACCAGCCTGG + Intergenic
1154370241 18:13754294-13754316 CCCAGGAGTTGAGACCGGTCTGG + Intronic
1154376490 18:13814619-13814641 GTCAGGAGTTCAGACCAGTGTGG - Intergenic
1155066672 18:22274215-22274237 CCCAGGAGTTGAGACCAGCCTGG - Intergenic
1156490427 18:37492753-37492775 CATAGAAGGTGAGACCAAAGTGG - Intronic
1157150959 18:45217439-45217461 CACAGTGGGTTAGAACAGTGAGG + Intronic
1157719150 18:49910217-49910239 AACTGGAGGAGAGCCCAGTGTGG + Intronic
1157957771 18:52117823-52117845 CCCTGGAGGTGAGGCCAGGGTGG - Intergenic
1159343980 18:67174742-67174764 CACAGGAGCAGAGAGCAGTGTGG + Intergenic
1159539963 18:69762098-69762120 CCCAGGAGTTAAGACCAGTCTGG + Intronic
1160870733 19:1276602-1276624 CCCAGGAGTTCAGACCAGCGCGG - Intronic
1161588841 19:5119610-5119632 GGCAGGAGGGGAGACCAGGGAGG - Intronic
1161904892 19:7149393-7149415 AACAGGAGGTGAGACTAAAGAGG - Intronic
1162112109 19:8404863-8404885 CACCGGAGGAGGGCCCAGTGGGG + Intronic
1162190227 19:8939227-8939249 CCCAGAACGAGAGACCAGTGAGG + Exonic
1162496817 19:11028013-11028035 CACAGGAGGGAATGCCAGTGAGG - Intronic
1162823591 19:13237671-13237693 CACAGCACTTGAGCCCAGTGTGG - Intronic
1163384665 19:16992208-16992230 GACAGGAGGTGAGGACAGAGAGG - Intronic
1164309373 19:24032882-24032904 GTCAGGAGTTCAGACCAGTGTGG + Intergenic
1165046536 19:33109007-33109029 CCCAGGAGTTGAGACCAGCTTGG + Intronic
1165411138 19:35662400-35662422 CTCAGGAGTTGAGACCAGCCTGG - Intergenic
1166071356 19:40390016-40390038 CATAGGAGGAGACACGAGTGCGG - Exonic
1167129760 19:47576657-47576679 CAGAAGAAGAGAGACCAGTGTGG + Intergenic
1167243716 19:48360996-48361018 CACAGGAGTTCAGACCAGCCTGG - Intronic
1167791826 19:51688174-51688196 CACAGGAGATGAGGCTGGTGGGG - Intergenic
1167943135 19:52963379-52963401 CTCAGGAGCTGAGCACAGTGTGG - Intergenic
1168062831 19:53902997-53903019 CCCAGGGGGTGAGGCCAGAGGGG + Intronic
925149879 2:1607623-1607645 CACAGGATGTGAGGCCACAGGGG - Intergenic
925848061 2:8051797-8051819 TACAGGATGTGAGACCCCTGTGG + Intergenic
926089044 2:10038186-10038208 GGCAGGAGGTGTGTCCAGTGTGG + Intergenic
927165273 2:20313720-20313742 CTCAGGAGGTGAGAGCTGAGGGG + Intronic
927587832 2:24324637-24324659 CCCAGGAGTTGAGACCAGCCTGG + Intronic
928071283 2:28219990-28220012 CCCAGGTGCTGAGACAAGTGAGG - Intronic
928219838 2:29394595-29394617 CACAGGAGGGGATTCCAGTGGGG + Intronic
928482610 2:31697833-31697855 TCCATGAGGTGAGACCAGAGTGG - Intergenic
928538707 2:32264221-32264243 GTCAGGAGTTGAGACCAGTCTGG + Intronic
928681316 2:33705578-33705600 CACAGGTGGTGAGACCAAAATGG + Intergenic
929598477 2:43190684-43190706 GAGAGGTGGTGCGACCAGTGAGG - Intergenic
930108390 2:47657743-47657765 TACTGGAGCTGAGCCCAGTGGGG + Intergenic
930398878 2:50857740-50857762 CACAGGAGGTGAGAATTGTAGGG - Intronic
930957110 2:57216819-57216841 CACAGGAGCTGGGACCAGACAGG + Intergenic
931276869 2:60752057-60752079 CTCAGGAGTTGAGACCAGCCTGG - Intergenic
931376547 2:61713315-61713337 TGCAGGCGGTGAGACCAGTTGGG + Intergenic
931560115 2:63552000-63552022 CCCAGGAGTTGAGACCAGCCTGG - Intronic
931644767 2:64411893-64411915 CTGAGAAGGTGTGACCAGTGAGG - Intergenic
932033854 2:68220247-68220269 CCAAGGAGGTGAGACTTGTGAGG + Intronic
932256226 2:70289599-70289621 CTCAGGAGTTGAGACCAGCCTGG + Intronic
932424881 2:71623857-71623879 CACAGGAGTTGAGATCAGCCTGG + Intronic
932611818 2:73205299-73205321 CTCAGGAGTTGAGACCAGCCTGG + Intronic
934994111 2:98941374-98941396 CACAGTATGTGAGAGCAGTTAGG - Intergenic
936032639 2:109084664-109084686 CGAAGGAGCTGAGACCTGTGAGG + Intergenic
937732796 2:125255226-125255248 CCCAGGAGTTGAGACCAGCCTGG - Intergenic
938105498 2:128527151-128527173 CAGAGGAGGAGCCACCAGTGAGG - Intergenic
939954855 2:148519240-148519262 CACAGCAGGGGAGACCACGGTGG + Intergenic
940524758 2:154799347-154799369 GTCAGGAGTTGAGACCAGTCTGG - Intronic
941101289 2:161298357-161298379 CTCAGGAGTTGAGACCAGCCTGG - Intergenic
941682564 2:168414747-168414769 CAAAGGAGGTGAGATCATTTTGG - Intergenic
942463359 2:176184971-176184993 CACGGGAGGTGACAGCAGAGGGG - Intergenic
944146711 2:196514345-196514367 CACAGGAGGAGACCACAGTGGGG + Intronic
945106851 2:206324185-206324207 CAGAGGAGGGGAGACCAGCCAGG - Intergenic
946325769 2:218984148-218984170 GACAGTAGGTGGGAGCAGTGTGG - Intronic
946408006 2:219502434-219502456 CACACGAGGTGAGAGCAGAGTGG + Exonic
946573364 2:221048622-221048644 CACAGAATGTGAGCTCAGTGAGG + Intergenic
947530633 2:230906805-230906827 CACAGGAGGTCAGAGAAGGGAGG + Intergenic
948618873 2:239220904-239220926 TACAGAAGGTGGAACCAGTGGGG - Intronic
948664628 2:239527165-239527187 CACAGGATGTGAGTACAGGGAGG - Intergenic
948707879 2:239806450-239806472 CTGAGTAGGTGGGACCAGTGAGG - Intergenic
1168836579 20:881628-881650 GAGAGGAGTTGAGACCAGGGAGG + Intronic
1169035799 20:2451016-2451038 CAGAAGCGGTGAGACCAGTGAGG - Intergenic
1169394661 20:5218964-5218986 CATAAGAAGTGAGACCAGTCAGG - Intergenic
1169464955 20:5829084-5829106 CCCAGGAGTTGAGACCAGCCTGG - Intronic
1170584994 20:17727948-17727970 CCCAGGAGCTGAGACCAGCCTGG - Intronic
1171282491 20:23912392-23912414 CACAGGGGGTGAGAGGAGGGTGG + Intergenic
1171970867 20:31564244-31564266 CATAGGTGGTGAGTTCAGTGAGG - Intronic
1172276360 20:33681807-33681829 CAGAGGCAGGGAGACCAGTGTGG - Intronic
1172368313 20:34366433-34366455 CACAGGAGTTAAGACCAGACTGG - Intronic
1172711069 20:36924037-36924059 CTCGGGAGTTGAGACCAGTCTGG + Intronic
1172744726 20:37197805-37197827 CTCAGGAGTTGAGACCAGCCTGG - Intronic
1173226868 20:41167263-41167285 CACAGGAGGTGAGACCAGTGAGG + Intronic
1173240252 20:41289209-41289231 CCCAGGAGTTGAGACCAGCCTGG - Intronic
1173448932 20:43144920-43144942 CATCAGAGGTGAGGCCAGTGGGG - Intronic
1174226730 20:49006717-49006739 CATAGGTGGGGAGGCCAGTGTGG + Intronic
1174393546 20:50232754-50232776 CATGGGAGGTGAGGCCAGGGAGG - Intergenic
1174635894 20:51999122-51999144 CTCAGGAGTTGAGACCAGCCTGG - Intergenic
1174900257 20:54492190-54492212 CCCAGGAAGTGAGACCAGTCTGG - Intronic
1175005624 20:55679141-55679163 GGCAGGAGGTGAGACCAGACGGG + Intergenic
1175251718 20:57613928-57613950 CACAGGAGCTGAGACCCTGGAGG - Intronic
1175283913 20:57824383-57824405 CACAGGAGTTGAGACCAAACTGG - Intergenic
1175533472 20:59690536-59690558 CACAGGAGGTGTGTGCAGAGTGG + Intronic
1175920017 20:62446320-62446342 CACAGGTGGTGAGGGCAGGGCGG + Intergenic
1176128470 20:63486436-63486458 CAGAGGAGGAGAGAGCAGTGTGG + Intergenic
1176949556 21:15029260-15029282 CACAGGAGATGAGGTCAGAGGGG - Intronic
1176978527 21:15352195-15352217 AGCAGGAGATGAGAGCAGTGAGG + Intergenic
1177404287 21:20645663-20645685 CACAGGAGGGAAGTCAAGTGGGG + Intergenic
1178484590 21:33010611-33010633 CACAGGAGGAGCACCCAGTGGGG - Intergenic
1179631452 21:42680992-42681014 CACAGGATTTGCAACCAGTGGGG + Intronic
1180160279 21:45996057-45996079 CCCAGGAGGTGCCCCCAGTGAGG + Intronic
1180884418 22:19230509-19230531 CCCAGGAGTTGAGACCACTGTGG + Intronic
1180939058 22:19645032-19645054 CACAGGAGGTGAGGCAGGAGGGG - Intergenic
1181464036 22:23101318-23101340 CACAGGATGTGGGACCAGTATGG - Intronic
1181510951 22:23388514-23388536 CACAGGCGGGGAGAGGAGTGGGG + Intergenic
1181519012 22:23434691-23434713 CACAGTGGCTGAGGCCAGTGGGG - Intergenic
1181994872 22:26869395-26869417 CAAAGGAGGTGAGAACATTTTGG + Intergenic
1182368244 22:29792933-29792955 CCCAGGAGGTGAGACTAGTCTGG + Intronic
1182650099 22:31844763-31844785 CTCAGGAGTTGAGACCAGCTTGG - Intronic
1182691931 22:32170333-32170355 CACAGGAGATGAGCTCAGGGTGG + Intergenic
1182996368 22:34816635-34816657 GACAGGAGATGAGACCAGAAAGG + Intergenic
1183502130 22:38186980-38187002 CAGAGGCTGGGAGACCAGTGAGG + Intronic
1183561712 22:38580128-38580150 CCCAGGAGGTGAGACCAAACCGG - Intronic
1183940187 22:41289934-41289956 CCCAGGATTTGAGACCAGTCTGG + Intergenic
1183953535 22:41366116-41366138 CACAGGACTTGAGACCAGCTTGG + Intergenic
1184075103 22:42171843-42171865 CACAGGGGTTTATACCAGTGAGG + Intronic
1184157950 22:42681076-42681098 GACAGGAGGGGAGAAGAGTGAGG - Intergenic
1184206057 22:43004131-43004153 CAGAGGAGGTGAAATGAGTGTGG + Intronic
1185295021 22:50048979-50049001 CACAGCAGGCCAGCCCAGTGTGG + Intronic
1185399214 22:50607301-50607323 CACAGCAGGTGACAGCGGTGGGG + Intronic
949515097 3:4800436-4800458 CACAGGAGTCCCGACCAGTGGGG - Exonic
949927053 3:9049695-9049717 CACTGGAGGAGGAACCAGTGAGG + Intronic
950212474 3:11134101-11134123 GACAGACGGTGAGACCAGTGAGG + Intergenic
950513548 3:13448397-13448419 CCCAGGAGTTGAGACCAGCCTGG - Intergenic
951146014 3:19228132-19228154 AACAGGAGGTGAGACAGGTAGGG - Intronic
951594015 3:24297649-24297671 AACAGCAGGCGAGAACAGTGAGG - Intronic
951768729 3:26230660-26230682 CACCAGGGGTGAGACCAATGTGG + Intergenic
952865141 3:37850255-37850277 CACATCAGGGGAGAGCAGTGAGG - Intergenic
953348268 3:42194444-42194466 CACAGAAGCTGAGACCAGCCTGG - Intronic
953398817 3:42593973-42593995 CATAAGAGGTGAGATCAGAGGGG + Intronic
953863083 3:46561822-46561844 GACAGGAGCTGAGAGCAGTGGGG + Intronic
953929409 3:46998558-46998580 CACTACAGGTGAGGCCAGTGGGG + Exonic
954065259 3:48100731-48100753 CCCAGGAGTTTAGACCAGTCTGG - Intergenic
954323639 3:49849218-49849240 CTCAGGAGTTGAGACCAGCTTGG - Intronic
954669251 3:52279315-52279337 CTCAGGAGTTGAGACCAGCCTGG + Intronic
955302281 3:57792925-57792947 CTCAGGAGTTGAGACCAGCCTGG + Intronic
955610022 3:60747055-60747077 CACAGGAGATAAAACCAGTAAGG - Intronic
956773603 3:72547389-72547411 GAGAGAAGGAGAGACCAGTGAGG - Intergenic
956816288 3:72911372-72911394 AACAGAAGGTGGGACCATTGGGG - Intronic
957789554 3:84921235-84921257 GCCAGGAGTTGAGACTAGTGTGG + Intergenic
959363680 3:105428123-105428145 CACAGGATATGAGAGTAGTGTGG - Intronic
959462701 3:106645869-106645891 TACAGGAGGTAAGAACAGAGGGG + Intergenic
960002373 3:112746328-112746350 GTCAGGAGTTGAGACCAGCGTGG + Intronic
960995331 3:123336610-123336632 CAGAGGAGGTGAGAAGAGGGAGG + Intronic
961162879 3:124744617-124744639 CCCAGGAGTTGAGACCAGCCTGG - Exonic
961565739 3:127762224-127762246 CTCAGGAGCAGAGCCCAGTGGGG - Intronic
961652652 3:128424856-128424878 CACAGAAGATGAGAGGAGTGGGG - Intergenic
961802661 3:129464567-129464589 CACAGAAGGTAAAACTAGTGAGG - Intronic
962527916 3:136252711-136252733 CCCAGGAGTTGAGACCAGCCTGG - Intronic
962528082 3:136253856-136253878 CCCAGGAGTTGAGACCAGCCTGG - Intronic
962648243 3:137462040-137462062 GGCAGGAGCTGAGGCCAGTGTGG + Intergenic
962916454 3:139908704-139908726 CTCAAGAGGAGACACCAGTGTGG - Intergenic
964410056 3:156388722-156388744 CACAGGATGTGAGGCATGTGAGG - Intronic
968665797 4:1821780-1821802 CACAGGAGGTGACAGCAGGTTGG + Intronic
968885934 4:3332129-3332151 CAAAGGGGCAGAGACCAGTGTGG + Intronic
968989288 4:3898174-3898196 AACAGGAGGTGAGTCCAGCGCGG + Intergenic
969070756 4:4536655-4536677 GAGAGGAGGTGAGGCCAGAGAGG + Intronic
969438741 4:7204635-7204657 CACAGGAGGAGAAACATGTGTGG + Intronic
969460697 4:7327279-7327301 CACCGGAGGTGGGACAGGTGAGG - Intronic
970375523 4:15453123-15453145 CTCAGGAGTTGAGGCCAGTCTGG + Intergenic
970853271 4:20626818-20626840 CTCAGGAGGTGTGCCCAGGGAGG + Intergenic
971825780 4:31620598-31620620 CTCAGGAGTTGAGACCAGCCTGG - Intergenic
972551473 4:40139305-40139327 CCCAGGAGTTGAAACCAGTCTGG - Intronic
972725575 4:41744634-41744656 TACAGGATGTGAGTCCAGTTCGG + Exonic
973249906 4:48049809-48049831 AGCAGGAGGTGAGCTCAGTGAGG + Intergenic
973862600 4:55079944-55079966 AACAGGAGGAGAGCTCAGTGTGG + Exonic
974707119 4:65533722-65533744 GTCAGGAGTTGAGACCAGTCTGG + Intronic
975258212 4:72264601-72264623 GTCAGGAGTTGAGACCAGCGTGG - Intergenic
975506349 4:75142943-75142965 AACAGGAGGTGATCCCAGTTTGG - Intergenic
976009351 4:80468431-80468453 CTCAGGAGTTGAGACCAGCCTGG - Intronic
976350838 4:84057985-84058007 CACAAGAGGTGAGAAGATTGAGG - Intergenic
976758079 4:88519635-88519657 CCCAGGAGTTGAGACCAGCCTGG + Intergenic
980122259 4:128740202-128740224 CTCAGGAGTTGAGACCAGCCTGG + Intergenic
980740696 4:136946661-136946683 CTCAGGAAGGGAGGCCAGTGGGG + Intergenic
981201443 4:141984040-141984062 CCTATGAGGTGAGACCAGAGTGG + Intergenic
982262461 4:153506913-153506935 CACAGAAGAGGAGACCAGAGTGG + Intronic
985428579 4:189855696-189855718 CTCCTGAGGTGAGACCAGAGTGG + Intergenic
985519760 5:368227-368249 CGCAGTAGGAGAGGCCAGTGGGG + Intronic
987435497 5:17888095-17888117 CAGAGGAGGGGAGATCACTGGGG - Intergenic
989303193 5:39918668-39918690 CTCAGGAGTTGAGACCAGCCTGG + Intergenic
989385323 5:40849763-40849785 CCCAGGAGTTGAGACCAGCCTGG + Intronic
989609063 5:43274102-43274124 CACATGAGGTGAGGCCATTGAGG + Intronic
989691116 5:44145478-44145500 CATATGAGGTGAGACCAGAGTGG + Intergenic
992199125 5:74367136-74367158 CAGAGGAGGTGGGACCAGGATGG - Intergenic
994099388 5:95877356-95877378 GACAGGAGGTGGGTACAGTGGGG + Intergenic
994881964 5:105509566-105509588 CACAGGAGTTGGAAACAGTGGGG + Intergenic
996452957 5:123647608-123647630 GACAGGAGGGAAGACCAGAGAGG + Intergenic
997286305 5:132681238-132681260 CTGAGGAGGAGTGACCAGTGAGG + Intronic
997551986 5:134761233-134761255 CTCAGGAGTTGAGACCAGCCTGG - Intronic
998107888 5:139480104-139480126 CCCAGGAGTTGAGACCAGGCTGG + Intronic
998403447 5:141860300-141860322 CCCAGGAGTTGAGACCAGCCTGG + Intronic
999695521 5:154185527-154185549 AACAGGAGATGAGAGCAGAGAGG + Intronic
1000602757 5:163295079-163295101 CACAGCAAGTTAGAGCAGTGAGG - Intergenic
1001418400 5:171565796-171565818 CTCAGGAGTTGAGACCAGTCTGG - Intergenic
1001729414 5:173939075-173939097 CCCAGGAGTTGAGACCAGCCTGG + Intronic
1001754763 5:174159781-174159803 CACAGGATGTGTGACTAATGGGG - Intronic
1001795805 5:174501496-174501518 AACAGGAGGTGGGACCAGGAGGG + Intergenic
1002060146 5:176621058-176621080 CCCAGGAGGTGGGAGCAGGGAGG - Intronic
1002537566 5:179885917-179885939 TGTAGGAGGTGAGACCAGAGAGG - Intronic
1002607457 5:180391541-180391563 CACAGGAGAACAGACCAATGGGG + Intergenic
1002707547 5:181172668-181172690 CTCATGAGTTGAGACCAGTCTGG - Intergenic
1003573417 6:7270893-7270915 GGCAGGAGGTGGCACCAGTGTGG + Intronic
1004358674 6:14951967-14951989 GACTGGAGGGGAAACCAGTGAGG - Intergenic
1004929347 6:20446775-20446797 CCCAGGAGTTGAGACCAGCCTGG - Intronic
1005340113 6:24835792-24835814 CACAGGAGTTGGGACCAGTGTGG - Exonic
1005945277 6:30590753-30590775 CAGAGGAGGGGAGACCACAGAGG - Exonic
1006418848 6:33921007-33921029 GAAAGGAGGTAAGCCCAGTGCGG + Intergenic
1006633880 6:35448631-35448653 CCCAGGAGTTGAGACCAGCCTGG + Intergenic
1006687373 6:35847416-35847438 CTCAGGAGTTGAGACCAGCCTGG - Intronic
1007038981 6:38703918-38703940 CCCAGGAGTTGAGACCAGCCTGG - Intergenic
1007449845 6:41934506-41934528 CACAGGTGGGGAGATGAGTGAGG - Intergenic
1007933374 6:45712228-45712250 CTCAGGAGTTGAGACCAGCCTGG - Intergenic
1008439437 6:51515843-51515865 CATTGGAGATGAGGCCAGTGTGG - Intergenic
1008837910 6:55860063-55860085 CACAGGATTTGAGACCAGCCTGG + Intronic
1009899438 6:69793928-69793950 CTCAGGAGTTGAGACCAGCCTGG - Intronic
1010431029 6:75778844-75778866 CCCAGGAGTTCAGACCAGTCTGG + Intronic
1011669101 6:89665235-89665257 CCCAGGAGTTGAGACCAGCCTGG - Intronic
1014664710 6:124222687-124222709 CTGAGGAGGAGAGGCCAGTGAGG + Intronic
1017311110 6:152978775-152978797 CTCAGGAGTTCAGACCAGTCTGG + Intronic
1017624796 6:156337616-156337638 AACAAGAGGTGACACCAGTCTGG - Intergenic
1017870710 6:158484135-158484157 TCCAGGAGGTGAGACCAGCCTGG - Intronic
1018496243 6:164348222-164348244 CAAAGGTGGTGAGGCCTGTGGGG + Intergenic
1019234325 6:170597119-170597141 CACAGGATGTGAGATCACTCAGG - Intergenic
1019872691 7:3780321-3780343 CCTAAGAGGTGAGACCAGAGTGG - Intronic
1020440876 7:8215233-8215255 CACAGAAGGTGAGGTGAGTGTGG - Intronic
1020725752 7:11811993-11812015 CACAGGTGGTCAGACAAGGGAGG + Intronic
1020778959 7:12494256-12494278 CACCACAGCTGAGACCAGTGTGG - Intergenic
1022288002 7:28973970-28973992 AACAGGAGGTGAGATCAGAGAGG - Intergenic
1022591783 7:31670810-31670832 CACAGGATGGGAGACCAGGTGGG - Intergenic
1022593215 7:31686287-31686309 CACTGGAGGAGAGCCCACTGGGG - Intergenic
1024894841 7:54245987-54246009 GACAGGAGATGAGATCAGAGAGG - Intergenic
1025165327 7:56707173-56707195 CCCAGCAGGTGAGAGGAGTGGGG - Intergenic
1026044994 7:66900973-66900995 CTCAGGAGTTGAGACCAGCCTGG - Intergenic
1027116618 7:75486281-75486303 CACAGGAAGCGAGGGCAGTGCGG + Intergenic
1027121944 7:75528103-75528125 CACAGGAAGCGAGGGCAGTGCGG + Intergenic
1027194208 7:76018075-76018097 CCCAGGAGTCGAGACCAGTCTGG - Intronic
1027329618 7:77077931-77077953 GTCAGGAGGTGAGACCAGCCTGG + Intergenic
1028970527 7:96853594-96853616 CACAGAAGAAGAGACCAGAGAGG - Intergenic
1029114879 7:98231767-98231789 CACAGGAGATGGGGCCAGGGAGG - Intronic
1029440560 7:100584695-100584717 CAGAGCAGGCGAGATCAGTGGGG + Intronic
1029659573 7:101950934-101950956 CAAAGGAAGTGAGACCAGTTAGG - Intronic
1029712757 7:102308552-102308574 CAGAGGAGCTGAGATCAGTGGGG + Intronic
1029786145 7:102793419-102793441 GTCAGGAGGTGAGACCAGCCTGG - Intronic
1031162582 7:118185453-118185475 CACTTGAGGTGAGACCAGCTTGG - Intronic
1031694271 7:124829906-124829928 CTCAGGAGTTGAGACCAGCCTGG - Intronic
1031866991 7:127048339-127048361 AATAGGAGGTGAGATCAGAGAGG + Intronic
1032288279 7:130561089-130561111 AACAGGAAGTGAGAGCAGTGTGG - Exonic
1032318683 7:130865139-130865161 CCCAGGAGTTGAGACCAGCCTGG + Intergenic
1032502247 7:132408924-132408946 CACAGAATGTGAGAGCAGAGTGG - Intronic
1032578245 7:133078459-133078481 CCCAGGAGTTGAGACCAGCTTGG + Intronic
1034318349 7:150155634-150155656 GACAGGAGATGAGACCACAGAGG - Intergenic
1034648673 7:152671829-152671851 CCCAGGAGTTGAGACCAGCCTGG + Intronic
1034774404 7:153811598-153811620 GACAGGAGATGAGACCACAGAGG + Intergenic
1034901031 7:154907907-154907929 CCCAGGAGGTGGGAGCAGGGAGG - Intergenic
1034949167 7:155285272-155285294 CACAGGGGATGAGACCTCTGGGG + Intergenic
1034972559 7:155428200-155428222 CACAGGAGCAGGAACCAGTGTGG + Intergenic
1035210410 7:157323869-157323891 CACATGAGGTGAGACCAGCCTGG - Intergenic
1035636106 8:1145446-1145468 CACAGGACGGGAGACCACAGTGG - Intergenic
1037050252 8:14363474-14363496 GACAGGAGGTGAGAACAGAAGGG + Intronic
1037455287 8:19057441-19057463 CACAGAAGGCGTGACCAGAGTGG - Intronic
1037932118 8:22887553-22887575 CCCAGGAGTTGAGACCAGCCTGG + Intronic
1038272224 8:26084528-26084550 CACAGGATGTGAGATCAGCTGGG + Intergenic
1041079513 8:54202897-54202919 CACAGGAACTAAGCCCAGTGAGG - Intergenic
1041451813 8:58013615-58013637 CACAGAGGGGGAGTCCAGTGGGG + Intronic
1041858485 8:62484177-62484199 GACAAGAGATGAGTCCAGTGAGG - Intronic
1042588474 8:70370009-70370031 CAGAGGAGCTGAGACCACAGGGG + Intronic
1043442166 8:80285870-80285892 CCCAGGAGTTGAGACCAGCTTGG - Intergenic
1048680050 8:136831517-136831539 CACAGGACATGAGACGGGTGTGG + Intergenic
1049098005 8:140560218-140560240 CACTGCAGGTGAGACCAGCCAGG + Intronic
1049535958 8:143182253-143182275 CACAGGAAGGGAGCCCTGTGTGG - Intergenic
1049827800 8:144681082-144681104 CACAGCAGGTGGAAACAGTGTGG + Intergenic
1049849737 8:144824456-144824478 CACCTGAGGTGAGACCAGCCTGG - Intergenic
1050138805 9:2496106-2496128 CCCAGGGGGTGAGACCACTGGGG - Intergenic
1050188164 9:2996990-2997012 CAGAGGGGGTGAGGACAGTGAGG + Intergenic
1050764298 9:9113183-9113205 CCCAGGATTTGAGACCAGTCTGG - Intronic
1051132125 9:13874713-13874735 CTCAGGAGTTGAGACCAGTCTGG - Intergenic
1051383819 9:16485560-16485582 CACATGAAATGAGCCCAGTGGGG - Intronic
1051686782 9:19666193-19666215 CCCAGGAGTTGAGATCAGCGTGG + Intronic
1053128566 9:35602304-35602326 CCCAGGAGTTGAGACCAGCCTGG + Intergenic
1053246690 9:36540491-36540513 CCCAGGAGTTGAGACCAGCCTGG - Intergenic
1053269543 9:36740517-36740539 CCCAGAAGGGGAGGCCAGTGAGG - Intergenic
1053385610 9:37684962-37684984 CCCAGGAGTTGAGACCAGCCTGG - Intronic
1054581051 9:66913467-66913489 CCCAGGGGGTCAGATCAGTGGGG + Intronic
1054708100 9:68483481-68483503 CACTGGAGAAGAGACCAGTGTGG + Intronic
1056069127 9:82967674-82967696 CACAAAAGGTGAGGCCACTGTGG + Intergenic
1056071690 9:82993760-82993782 CACAGAATGTGAGATGAGTGTGG + Intronic
1056748257 9:89323842-89323864 CAGAGGAGGAAGGACCAGTGAGG + Intronic
1059479273 9:114575879-114575901 GTCAGGAGGTGAGACCAGCCTGG - Intergenic
1059998995 9:119941598-119941620 CACAGGGGGTGTCAGCAGTGGGG - Intergenic
1061247492 9:129408196-129408218 CACTGGAGCTGAGACCTGGGTGG - Intergenic
1061651641 9:132055023-132055045 CACAGCAGGAGGGAGCAGTGAGG - Intronic
1062287053 9:135777980-135778002 CACAGGAGCTGAGAGCATGGAGG - Intronic
1062460964 9:136662427-136662449 CACAGGAGCCTTGACCAGTGAGG - Intronic
1062564980 9:137160265-137160287 CACAGGACCTGGGACCCGTGGGG - Intronic
1062689784 9:137835219-137835241 CTCAGAAGGTGATGCCAGTGCGG - Exonic
1185586089 X:1243032-1243054 CACAGGAGGAAAGAGCAGGGGGG + Intergenic
1186474364 X:9845702-9845724 CAGACGGGGTGAGACCAGAGAGG - Intronic
1188738687 X:33750230-33750252 CCCAGGAGATGAGACCAGTCTGG - Intergenic
1188965881 X:36550547-36550569 CCCAGGAGTTGAGACCAGCCTGG + Intergenic
1189156025 X:38757525-38757547 GACAGGCAGTGGGACCAGTGTGG - Intergenic
1189436360 X:40996375-40996397 CCCAGGAGTTGAGACCAGCCTGG - Intergenic
1190186695 X:48241186-48241208 GACAGGAGTTGAGACCAGCCTGG + Intronic
1190593810 X:52032899-52032921 CCAAGAAGGTGAGAGCAGTGAGG + Intergenic
1190635914 X:52433819-52433841 CACAGGAGATGAGACCAACCTGG + Intergenic
1190702871 X:53001068-53001090 CACAGGAGGTGAGATCCAAGAGG + Intergenic
1191054204 X:56225483-56225505 GACAGAAGGTGAGACCTTTGAGG + Intergenic
1192217066 X:69167142-69167164 CCCAGGAGTTGAGACCAGCCTGG + Intergenic
1192809663 X:74537021-74537043 CACAGTGGGTCAGCCCAGTGGGG + Intergenic
1194957368 X:100196692-100196714 CACAGAAGGTGCTACCTGTGAGG + Intergenic
1195052137 X:101106849-101106871 CCCAGGATGTGAGACCAGCCTGG + Intronic
1195390483 X:104357044-104357066 GACAGGAGTTGAGACCAGCCTGG + Intergenic
1197740184 X:129885509-129885531 CTCAGGAGTTGAGACCAGCCTGG + Intergenic
1198160371 X:134002230-134002252 GCCAGGAGTTGAGACCAGTCTGG + Intergenic
1198214686 X:134545471-134545493 CTCAGGAGGCCAGCCCAGTGAGG + Intergenic
1200359793 X:155592635-155592657 CCCATGAGGTGAGACTAGAGTGG - Intronic