ID: 1173228230

View in Genome Browser
Species Human (GRCh38)
Location 20:41174470-41174492
Sequence CATTGACCCGAGTCCTTCTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 46}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173228230_1173228235 14 Left 1173228230 20:41174470-41174492 CCCAAGAAGGACTCGGGTCAATG 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1173228235 20:41174507-41174529 TAGTTGTACCCCAGCCTCGTTGG 0: 1
1: 0
2: 0
3: 6
4: 76
1173228230_1173228239 25 Left 1173228230 20:41174470-41174492 CCCAAGAAGGACTCGGGTCAATG 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1173228239 20:41174518-41174540 CAGCCTCGTTGGAGAGCAGCAGG 0: 1
1: 2
2: 3
3: 10
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173228230 Original CRISPR CATTGACCCGAGTCCTTCTT GGG (reversed) Exonic
904453105 1:30629170-30629192 CAATCACCCAAGTCCTGCTTGGG - Intergenic
910203671 1:84725823-84725845 CCTTCACCCTACTCCTTCTTTGG + Intergenic
911682371 1:100732155-100732177 CATTGACCCTCGTCATTCTTTGG + Intronic
912327827 1:108785378-108785400 CAATGACCTGAGTTCTACTTTGG + Intronic
923601568 1:235407748-235407770 CAGTCACCCGTGTCCTTCCTAGG + Intronic
1085623542 11:78055189-78055211 CGTTGACCCCAGTCCATCTGCGG + Intronic
1091640298 12:2230896-2230918 CTTTGGGCCAAGTCCTTCTTTGG - Intronic
1104752286 12:131247462-131247484 GAGTGACCCGTGTCCTTCATGGG + Intergenic
1107371887 13:39760168-39760190 GATTGCCCCGAGTCTTTCTGGGG + Intronic
1109358243 13:61261335-61261357 CATTCACAGGAGGCCTTCTTTGG + Intergenic
1110215024 13:73015419-73015441 TATTTACCAGAGTACTTCTTGGG - Intronic
1122317818 14:100836082-100836104 CCGTGCCCCGAGTCTTTCTTCGG + Intergenic
1138081673 16:54096552-54096574 CATTGACTCCAGTACTTCCTGGG - Intronic
1156149054 18:34222646-34222668 CATTGTCCCATGTCCTTCTCTGG - Intronic
1158213841 18:55079127-55079149 CATGGAACCGATTCCTTCTCAGG - Intergenic
1159948480 18:74461081-74461103 CTCTCACCCGAGTCCTTCTGGGG - Intergenic
1161216361 19:3096831-3096853 CACTGACACCAGTCCTCCTTGGG - Intronic
926425615 2:12736266-12736288 GCTTGACCCCAGTCCTTCTGAGG - Intronic
931932617 2:67157121-67157143 CACTGACCAGAGTCTTTTTTGGG + Intergenic
941497966 2:166230720-166230742 CATTGACCCTACTCACTCTTTGG + Intronic
1169376310 20:5069230-5069252 CCTTGAGCTGAGTCCTCCTTCGG + Intronic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1173228230 20:41174470-41174492 CATTGACCCGAGTCCTTCTTGGG - Exonic
1174268667 20:49350846-49350868 CATAGACCCGAGTCCTGTTATGG + Intergenic
1184833575 22:47007014-47007036 CATGGCACAGAGTCCTTCTTGGG - Intronic
950112226 3:10426591-10426613 CATTTCCCCAAGTCCTTCTGTGG - Intronic
952948160 3:38495233-38495255 CATCAACCAGAGTCCTTCCTAGG - Intergenic
953529689 3:43729146-43729168 CTTTGACCCCAGTCCTTTCTGGG - Intronic
972439494 4:39072811-39072833 CACTGACCCAAGTCTCTCTTTGG - Intronic
974829443 4:67172281-67172303 CATTCACAAGAGTCCTGCTTTGG + Intergenic
980634676 4:135485442-135485464 CATAGACCTGAGTCCATCCTAGG + Intergenic
983836728 4:172396180-172396202 CCTTGACCTGAGCCCTTCCTCGG + Intronic
991519188 5:67476453-67476475 CATTGACTCAAGTCATTCTTTGG + Intergenic
994867474 5:105294886-105294908 CATTTACTCCTGTCCTTCTTTGG - Intergenic
998527905 5:142859243-142859265 CATGGACCCAAGTCTTTCTCAGG + Intronic
1003926246 6:10880645-10880667 CATCCACCCCAGTCATTCTTTGG + Intronic
1005420619 6:25645000-25645022 CATTGACGGGACTCCTCCTTAGG - Intergenic
1005917530 6:30366182-30366204 CACTGACCCAAGTCTTGCTTGGG - Intergenic
1012199258 6:96385408-96385430 CTTTGACCTGATTTCTTCTTGGG - Intergenic
1012217651 6:96607656-96607678 CATTGACCCTGGTAATTCTTTGG - Intronic
1012475410 6:99611290-99611312 CATTGAGCTGAGTCATTCTGCGG + Intronic
1013428813 6:110038072-110038094 CATTGACCCAAATCCCTCTCTGG + Intergenic
1013777309 6:113692658-113692680 CATTGACCTGTGTCCTTCTGAGG - Intergenic
1017820227 6:158043893-158043915 CACTGACCAGAGCCCTGCTTTGG - Intronic
1021668574 7:23013345-23013367 CGTTGGCCCGAGTCGGTCTTTGG - Intronic
1026456424 7:70576278-70576300 CTTTGACCCCTTTCCTTCTTAGG - Intronic
1040389149 8:46934707-46934729 CATTTACCCTAGCCCTGCTTGGG + Intergenic
1049690602 8:143957305-143957327 CACAGACCCGCGTGCTTCTTCGG - Intronic
1050653074 9:7794006-7794028 CATTGGCCTAAGACCTTCTTTGG + Intergenic
1057140812 9:92725835-92725857 CCTTCACCCTACTCCTTCTTGGG + Intronic
1186622156 X:11252837-11252859 CACTGACCAGAGTTTTTCTTTGG - Intronic