ID: 1173228644

View in Genome Browser
Species Human (GRCh38)
Location 20:41177116-41177138
Sequence CAGTGGTACCAGAAGGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173228637_1173228644 10 Left 1173228637 20:41177083-41177105 CCAAAAGAGCAGGCAGGGCCGGG 0: 1
1: 0
2: 0
3: 17
4: 261
Right 1173228644 20:41177116-41177138 CAGTGGTACCAGAAGGTAGATGG 0: 1
1: 0
2: 2
3: 13
4: 186
1173228632_1173228644 30 Left 1173228632 20:41177063-41177085 CCTGATTTTGGCAGCACAAACCA 0: 1
1: 0
2: 1
3: 9
4: 132
Right 1173228644 20:41177116-41177138 CAGTGGTACCAGAAGGTAGATGG 0: 1
1: 0
2: 2
3: 13
4: 186
1173228642_1173228644 -8 Left 1173228642 20:41177101-41177123 CCGGGAGAGGGAAGTCAGTGGTA 0: 1
1: 0
2: 1
3: 13
4: 188
Right 1173228644 20:41177116-41177138 CAGTGGTACCAGAAGGTAGATGG 0: 1
1: 0
2: 2
3: 13
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173228644 Original CRISPR CAGTGGTACCAGAAGGTAGA TGG Intronic
902663312 1:17920437-17920459 CAGTGGAGCCATAGGGTAGAAGG + Intergenic
906093313 1:43201360-43201382 CAGTGGTACTAGATGTCAGAGGG + Intronic
906456424 1:46001146-46001168 CCTTGGTTCCAGCAGGTAGAGGG - Intronic
906591003 1:47023980-47024002 CTTGGGCACCAGAAGGTAGATGG + Exonic
906607550 1:47182509-47182531 AAGTGGGGCCAGAAGGTAGGAGG - Intergenic
907087962 1:51695459-51695481 CAGTGGAACCATGAGGTAGTTGG + Intronic
907517055 1:54999349-54999371 CAGTGCTACCCCAAGGTAGGTGG + Exonic
907879807 1:58537347-58537369 CAGTGATTCCACAAGGTACAAGG + Intronic
911032168 1:93500684-93500706 TAGTGGTCCCAGAAGGAAGGGGG + Intronic
920152667 1:203921186-203921208 AAGAGGAACCACAAGGTAGAGGG - Intergenic
920664440 1:207951179-207951201 AAGTGGTAGTGGAAGGTAGAGGG - Intergenic
921279611 1:213552883-213552905 CAGTAGTGCTTGAAGGTAGAAGG - Intergenic
922972790 1:229757366-229757388 CAGTGGAACCACAAGCTAAAAGG - Intergenic
1063512080 10:6655452-6655474 CAGTCATGACAGAAGGTAGAGGG - Intergenic
1065983653 10:30928903-30928925 CAGTGATATCAGGAGGTTGAAGG - Intronic
1070442280 10:76458530-76458552 CAGTGGTACCTGAGGGTGAATGG + Intronic
1071850524 10:89564634-89564656 TAATAGTACTAGAAGGTAGAAGG + Intergenic
1074105647 10:110388028-110388050 CATTGAGAACAGAAGGTAGAAGG + Intergenic
1074740214 10:116479236-116479258 CAGTGGTACCACAGAGAAGACGG + Intergenic
1075705226 10:124496641-124496663 CAGGGGACCCAGAAGGCAGACGG - Intronic
1078028432 11:7722456-7722478 CAGTGGTTCAAGATGGGAGAGGG + Intergenic
1079704393 11:23595747-23595769 CAAAGGAACCAGAAGGTACAGGG + Intergenic
1080640251 11:34154491-34154513 CAGGAGTATCAGAAGGTAGTGGG - Intronic
1088899204 11:114102473-114102495 CAGTGGTAACAGTGGTTAGAGGG + Intronic
1088961579 11:114671605-114671627 CAGTGGCACCAGAAGGCAGTAGG + Intergenic
1089319540 11:117615638-117615660 CGGTTGTACCAGATTGTAGAAGG + Intronic
1089403650 11:118180217-118180239 CAGAGTTGCCAGAAGGCAGAAGG + Intergenic
1092662833 12:10756879-10756901 CAGTGGTAACACAAGTTAGTTGG + Intergenic
1101338261 12:103816508-103816530 CAGTGGACCCTGATGGTAGAAGG - Intronic
1102591199 12:113958103-113958125 CAGAGGTAGCAAATGGTAGATGG + Intronic
1102747836 12:115265565-115265587 TAGTGCTTCCAGAAGTTAGAAGG + Intergenic
1104781822 12:131426498-131426520 CAGTAGTTCCAGAAGGGAGGAGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1115023144 14:28707571-28707593 CAGTGGGACCAAAAGCAAGAAGG + Intergenic
1116885094 14:50212874-50212896 CAGTAATACTAGAAGCTAGATGG + Intronic
1122311897 14:100802767-100802789 CAGCGGTACCAAAAGGACGAGGG - Intergenic
1125909189 15:43421032-43421054 CAGTGGTCCGAGAAGGTGGGCGG + Exonic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1126183593 15:45809794-45809816 CAGATGTAGCAGAAGGTAGAAGG + Intergenic
1126854414 15:52824111-52824133 AAGAGGTACCAAAAGGTATAAGG + Intergenic
1127630717 15:60825153-60825175 CAGTGGCACAAGAATTTAGAAGG - Intronic
1128733195 15:70034554-70034576 CTGTGCTACCACAAGGTAGAAGG + Intergenic
1130112529 15:80977501-80977523 AAGTGGAAACAGAAGGTACAGGG + Exonic
1130943735 15:88534520-88534542 CAGTGGAACCAGAAGGTACTGGG + Intronic
1131077763 15:89506558-89506580 CACTGGTACCACAAGCTGGAAGG - Intergenic
1135755994 16:25098635-25098657 CAGCTGTACCAGTTGGTAGAGGG - Intergenic
1136183374 16:28570253-28570275 CAGTGTGTCCAGAAGGTAGGAGG + Intronic
1138527564 16:57617884-57617906 TTGGGGTACCAGAAGGGAGAAGG - Intronic
1139154570 16:64424920-64424942 CAATTGTACCAGAAGGAAGAGGG - Intergenic
1141286861 16:82680810-82680832 CAATGGAACCAGGAGATAGAAGG + Intronic
1143373100 17:6452449-6452471 CAGGCATACCAGAAGCTAGAAGG + Exonic
1144215044 17:13047960-13047982 AAGTTGTACCAGGAGCTAGAAGG - Intergenic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1145415187 17:22708773-22708795 CAGTGCTACCCCAAGGTATATGG + Intergenic
1145784274 17:27584129-27584151 CAGGGGTACAAGAAGGTAAGAGG - Intronic
1146423518 17:32712979-32713001 CATGGATACCAGGAGGTAGAGGG + Intronic
1149344878 17:55724636-55724658 AAGTGGTACTAGAAAATAGAGGG - Intronic
1149939665 17:60850323-60850345 CAGTGGTGCCAGGAGTTAGGGGG - Intronic
1150222800 17:63506745-63506767 CAGTTGGACCAGGAGGTGGATGG + Intronic
1151658263 17:75505752-75505774 AAGTGGTACCAGGATGTGGAGGG - Intronic
1152421552 17:80195969-80195991 CAGTGGTTTCAGAAGGCAGCAGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157108234 18:44794733-44794755 CAGTGGTATGTGAAGGTAGGAGG - Intronic
1157486469 18:48090795-48090817 CAGTGGAACTGGAAGGTAGATGG - Intronic
1157640964 18:49214107-49214129 CAGTGGTACAAAAAGATACATGG + Intronic
1159406582 18:68010470-68010492 CAGTGGTTCGGGAAGGGAGACGG - Intergenic
1159888892 18:73936320-73936342 CTGTGGTACCATAATGTTGAGGG - Intergenic
1161776257 19:6263849-6263871 CACTGGTGCCAGAAGGCTGAAGG + Intronic
1165194737 19:34093093-34093115 CAGTGGTTCATTAAGGTAGATGG - Intergenic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
1166742703 19:45123924-45123946 CAGTAGACCCTGAAGGTAGATGG - Intronic
925323288 2:2993753-2993775 CAGAGGTCCCAGTAGGTAGGTGG + Intergenic
926634201 2:15163287-15163309 GAGTGGGACTAGAAGGGAGAAGG + Intergenic
926887724 2:17613189-17613211 CAGTGGAACAAGAAGGTCTATGG + Intronic
927420495 2:22925800-22925822 TAGTGTTATAAGAAGGTAGAGGG - Intergenic
927516705 2:23675789-23675811 CAGTGTTGCCTGAAGTTAGAGGG + Intronic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
931889384 2:66654115-66654137 CTGTGGAAATAGAAGGTAGATGG + Intergenic
932552801 2:72788848-72788870 CAGTGGTAGCACAAGGAATATGG - Intronic
936666185 2:114598454-114598476 CAGAGGTAGCAGGAAGTAGAAGG + Intronic
937629591 2:124085544-124085566 CAAAGGTAGCAGAAGGAAGAGGG - Intronic
937955096 2:127417670-127417692 CCGGGGTGCCAGAAGGGAGAAGG - Intergenic
939112320 2:138023079-138023101 CAATGGTACTACTAGGTAGAGGG + Intergenic
944166741 2:196730728-196730750 CAGTAGCACCTGAAGTTAGAAGG + Intronic
945198258 2:207257298-207257320 CAGTGGGTGCAGCAGGTAGAAGG + Intergenic
945400973 2:209382437-209382459 CAGGGATTGCAGAAGGTAGAGGG + Intergenic
947996838 2:234534996-234535018 GAGTGAAACCAGAAGGGAGAGGG - Intergenic
948688024 2:239683374-239683396 CAGTGGTACAAGAAGGGTGGAGG - Intergenic
1171164290 20:22957010-22957032 CAGTGCTACCTGAAGGTAGGGGG - Intergenic
1171543052 20:25979218-25979240 CAGGTGCACCAGAAGGTGGAGGG - Intergenic
1172634386 20:36400262-36400284 CGCTGGTACCACAAGCTAGAGGG - Intronic
1172867527 20:38111727-38111749 AGGTGGTGACAGAAGGTAGATGG + Intronic
1173228644 20:41177116-41177138 CAGTGGTACCAGAAGGTAGATGG + Intronic
1173338621 20:42134481-42134503 AACTGGTGGCAGAAGGTAGAAGG + Intronic
1174883017 20:54301956-54301978 CAGGGGCTCCAGAATGTAGACGG - Intergenic
1175640111 20:60621974-60621996 CACTGGTATCAGAAGGTGGTCGG + Intergenic
1176294293 21:5062794-5062816 CTGTGGCACGAGCAGGTAGACGG - Intergenic
1176908263 21:14530739-14530761 CAGTGGTTACAGAAGATAGTGGG + Intronic
1179571731 21:42282547-42282569 CAGTGGTCCCAGATGGAAGGAGG - Intronic
1179812003 21:43877829-43877851 CAGTGGAGACAGAAGATAGAGGG - Intronic
1179862967 21:44200854-44200876 CTGTGGCACGAGCAGGTAGACGG + Intergenic
1180199634 21:46216474-46216496 CAGTGGCACCAGAGTGTGGAGGG + Exonic
1182512102 22:30826897-30826919 CAGTGGGACCAGAATGGAAAGGG - Intronic
1182776955 22:32838364-32838386 GAGTGCTACCACAAGGAAGAGGG + Intronic
950950837 3:16996548-16996570 CAGTGGGACCATAAGGGAAATGG + Intronic
956154284 3:66278400-66278422 GAGTGGAACCAGAATGGAGAGGG - Intronic
956253890 3:67263573-67263595 CAGTGCTACCAGCAGGAACATGG - Intergenic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
957955312 3:87178680-87178702 CAGAGGGAGAAGAAGGTAGAAGG - Intergenic
958552449 3:95634662-95634684 TAGTGGAAAAAGAAGGTAGAAGG - Intergenic
961135356 3:124504979-124505001 AAGGGGTACAAGAAGGGAGATGG + Intronic
962488080 3:135864216-135864238 CCTTGGTAGCAGAAGGAAGAGGG - Intergenic
963271166 3:143287080-143287102 AAGTGGGACCAGAAGGAAGGAGG - Intronic
963404516 3:144845013-144845035 AATTGGTACCAGGAGGTAGTGGG - Intergenic
964560997 3:157996520-157996542 AAGTGGAAGCAGAAGGCAGAAGG + Intergenic
965023136 3:163261165-163261187 AAGTGATAACAGATGGTAGAAGG - Intergenic
965353596 3:167646215-167646237 GAGTTGCACCAGAAGGAAGAAGG + Intronic
966092642 3:176159027-176159049 CATTTGTAGCAGAAGGAAGATGG + Intergenic
966349699 3:179018955-179018977 CTGCTCTACCAGAAGGTAGAGGG - Exonic
968453047 4:684062-684084 CACTGATCCCAGAAGGCAGAGGG + Intronic
968900700 4:3430501-3430523 CTGTGGAACCAGGAGGTAAACGG - Exonic
972349721 4:38225531-38225553 CAGGGGACCCAGAAGGCAGAAGG - Intergenic
976356267 4:84121025-84121047 CAGGGAGACCACAAGGTAGAAGG + Intergenic
977100340 4:92803939-92803961 AGGGGCTACCAGAAGGTAGATGG - Intronic
977474685 4:97490589-97490611 CAGTGAAACCAGGAGGTACAGGG - Intronic
977756949 4:100682782-100682804 CAGGGGAGCCAGAAGGGAGATGG - Intronic
978092680 4:104737185-104737207 CAGAGGTAATAGACGGTAGATGG + Intergenic
978337732 4:107687903-107687925 CAGAGGGACCATAAGGAAGATGG - Intronic
978352881 4:107838892-107838914 CAGTGGCTACAGAAGGCAGATGG - Intronic
980498688 4:133619337-133619359 CAGTTATACCAGAAGGTGGCTGG - Intergenic
981254640 4:142647408-142647430 TATTGGTACAAGAAGATAGAGGG + Intronic
982629693 4:157816756-157816778 TAGTGGTGAGAGAAGGTAGATGG + Intergenic
983865844 4:172765614-172765636 CAGTAGCACCAGAAAATAGATGG + Intronic
984261249 4:177445337-177445359 CGGGGGAACCAGAAGGGAGACGG - Intergenic
985365775 4:189231075-189231097 CAATTGTAGCAGAAGGTGGAGGG + Intergenic
987098194 5:14568350-14568372 AAGTGGAACCAGAAAGTAAATGG + Intergenic
987179035 5:15347117-15347139 CAGAGCTATCAGAAAGTAGATGG - Intergenic
987284310 5:16440713-16440735 CAGTGGGCCCAGACGGTTGAGGG + Intergenic
988470946 5:31537865-31537887 CGGTGGTGCAAAAAGGTAGAAGG - Intronic
988964078 5:36398426-36398448 CAGGGGTACATGAAGTTAGATGG + Intergenic
990232521 5:53729129-53729151 CTGTAGTCCCAGAAGGTGGAGGG + Intergenic
993527061 5:88977821-88977843 CAAGAGTACCAGAAGGTAGAGGG + Intergenic
993602242 5:89941520-89941542 CAGTGGTAAAGGAAGGGAGAGGG + Intergenic
996304927 5:122036196-122036218 AAGTGGTATCAGAAGGTCCAAGG - Intronic
998618043 5:143762448-143762470 CAATGCTAACTGAAGGTAGAGGG - Intergenic
1001231107 5:169989522-169989544 CTATGGTCCCAGAAGGCAGAGGG + Intronic
1001692716 5:173644710-173644732 CAGTGGAACCAGAAAATGGAGGG - Intergenic
1001821384 5:174713066-174713088 ATGTGGTACCAGAGGGTACAGGG - Intergenic
1002087996 5:176787746-176787768 GAATGGTCCCAGAAGGAAGAGGG - Intergenic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1002992410 6:2250059-2250081 CAGTTGGACCAGAAAGCAGAAGG - Intergenic
1004038553 6:11950409-11950431 CTGAGGTATCAGAAGATAGAGGG - Intergenic
1005298678 6:24450112-24450134 CAGAGATGCCAGAAAGTAGAGGG + Intronic
1005471179 6:26164166-26164188 CAGTGGTAGCAGGAGGTGGCAGG + Intronic
1007254706 6:40520664-40520686 CAGTGGTGCCAGCAAGGAGAGGG + Intronic
1008665082 6:53708127-53708149 AAGTAATACCAGAAGGTACAAGG - Intergenic
1010467311 6:76183778-76183800 TAGGGGTCCAAGAAGGTAGAGGG + Intergenic
1011169550 6:84490400-84490422 AATTGGTACCAGGAGGTAGTGGG - Intergenic
1012497967 6:99855741-99855763 CAGTGGTAGCAGGAGGCAGCGGG - Intergenic
1015036937 6:128667431-128667453 CTGTGGTAGTTGAAGGTAGAGGG + Intergenic
1015775205 6:136806969-136806991 CAGTGGTATCAAAAGGAAAAGGG - Intergenic
1018696944 6:166397788-166397810 CTGTGGTCCCAGAAGGTGGAGGG - Intergenic
1020850708 7:13348887-13348909 AAGTGGTAAAAGAAGGAAGAGGG + Intergenic
1024891897 7:54212883-54212905 CACTGGTAGCAGTAAGTAGACGG + Intergenic
1027338112 7:77175961-77175983 CAGTGTTATCAGAAGGGAAAGGG + Intronic
1028697263 7:93729041-93729063 CAGTTGTAACAAAAGTTAGAAGG - Intronic
1029777615 7:102694832-102694854 CAGTGTTATCAGAAGGGAAAGGG - Intergenic
1032435661 7:131898355-131898377 CAGTTGTACAAGAGGGTAGGCGG + Intergenic
1034919523 7:155068505-155068527 CAGAGGTACCATATGGCAGACGG + Exonic
1035572766 8:684549-684571 CAGTGGTACCACAGAGAAGAGGG + Intronic
1036010120 8:4712758-4712780 CAGTGGTCCCAAAAGAAAGAAGG - Intronic
1036399876 8:8398577-8398599 CAGTGGTCACAGAATGTAGCAGG + Intergenic
1042286770 8:67121765-67121787 CAGTGAAACCATAAGGTACAGGG + Intronic
1044189454 8:89297611-89297633 CAGTGGTGGCAGAAGGCAAAGGG + Intergenic
1047472448 8:125190391-125190413 CAGTAGAACCAGAAGACAGACGG + Intronic
1048349237 8:133602611-133602633 CAGTGATAGCAGAAAGAAGAGGG + Intergenic
1048451913 8:134540978-134541000 CACTGGCACCAGAGGGGAGAGGG + Intronic
1048639059 8:136332552-136332574 CTGTGGTACCAAAAGGCAGGAGG + Intergenic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050069948 9:1800114-1800136 CAGTGGTAAATGAAGGCAGATGG - Intergenic
1056297329 9:85206003-85206025 CACTGGTCCCAGGAGGAAGATGG + Intergenic
1056412546 9:86345332-86345354 CAGTGGTAACAGAGGATAGGTGG + Intronic
1058776631 9:108290582-108290604 CAATGGAACCAGAAGCTAGAGGG + Intergenic
1059197520 9:112384318-112384340 CATTAGTACCAGAATATAGAAGG - Intronic
1059205213 9:112458081-112458103 CAGTGGCACTAGAAGGTAGATGG - Intronic
1185688228 X:1948141-1948163 AAGTGGTAGGAGAGGGTAGAAGG + Intergenic
1185688517 X:2133680-2133702 AAGTGGTAGGAGAGGGTAGAAGG + Intergenic
1187333355 X:18360892-18360914 GAGTGGTAGCAGCAGCTAGAGGG - Intergenic
1187631256 X:21175267-21175289 TAGTGGAACCAGAAGATGGAAGG - Intergenic
1188368952 X:29345312-29345334 CAGTGCTTCCAAAAGATAGAGGG - Intronic
1190526020 X:51330804-51330826 CAATGGTGGCAGAAGGCAGAGGG + Intergenic
1192751181 X:73993260-73993282 CAGTGGTGCTAGAAGATAAATGG - Intergenic
1193113868 X:77756731-77756753 CAGTGAGACCAAAATGTAGAAGG - Intronic
1194839007 X:98715493-98715515 CTGTAGTGGCAGAAGGTAGAGGG + Intergenic
1195367292 X:104138711-104138733 CGGGGGAACCAGAAGGGAGATGG + Intronic
1195418015 X:104641536-104641558 CAGTGGGACCAGAATATAAAAGG - Intronic
1196000305 X:110776737-110776759 CAGTGGTAACAGGGGGTATATGG - Intronic
1196688672 X:118535433-118535455 AAGTGGTAACAGAAAGTACAAGG + Intronic
1197734826 X:129843176-129843198 CAGGGAAACGAGAAGGTAGAAGG + Intronic
1198040582 X:132847675-132847697 CAGAGGGACCAAAAGGGAGAGGG + Intronic
1199390419 X:147271582-147271604 GAGTGGTAGGAGAAGGTATAGGG + Intergenic
1199490855 X:148399024-148399046 CAGTGGGACCAGTAGGTAGAAGG - Intergenic