ID: 1173228658

View in Genome Browser
Species Human (GRCh38)
Location 20:41177194-41177216
Sequence CAGACCAGGGACAAGTAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 167}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173228648_1173228658 29 Left 1173228648 20:41177142-41177164 CCCTTGCAGGCTCCTTGTTCTCC 0: 1
1: 1
2: 4
3: 23
4: 255
Right 1173228658 20:41177194-41177216 CAGACCAGGGACAAGTAGACTGG 0: 1
1: 0
2: 2
3: 12
4: 167
1173228654_1173228658 -2 Left 1173228654 20:41177173-41177195 CCAGTAGAACCTTCTGGCTGACA 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1173228658 20:41177194-41177216 CAGACCAGGGACAAGTAGACTGG 0: 1
1: 0
2: 2
3: 12
4: 167
1173228650_1173228658 17 Left 1173228650 20:41177154-41177176 CCTTGTTCTCCTGCCATCACCAG 0: 1
1: 0
2: 2
3: 38
4: 351
Right 1173228658 20:41177194-41177216 CAGACCAGGGACAAGTAGACTGG 0: 1
1: 0
2: 2
3: 12
4: 167
1173228651_1173228658 8 Left 1173228651 20:41177163-41177185 CCTGCCATCACCAGTAGAACCTT 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1173228658 20:41177194-41177216 CAGACCAGGGACAAGTAGACTGG 0: 1
1: 0
2: 2
3: 12
4: 167
1173228649_1173228658 28 Left 1173228649 20:41177143-41177165 CCTTGCAGGCTCCTTGTTCTCCT 0: 1
1: 0
2: 1
3: 29
4: 352
Right 1173228658 20:41177194-41177216 CAGACCAGGGACAAGTAGACTGG 0: 1
1: 0
2: 2
3: 12
4: 167
1173228652_1173228658 4 Left 1173228652 20:41177167-41177189 CCATCACCAGTAGAACCTTCTGG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1173228658 20:41177194-41177216 CAGACCAGGGACAAGTAGACTGG 0: 1
1: 0
2: 2
3: 12
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173228658 Original CRISPR CAGACCAGGGACAAGTAGAC TGG Intronic
900458291 1:2787787-2787809 CAGGCCAGGTACATGGAGACGGG - Intronic
901432166 1:9223046-9223068 CAGGCCAGGGACCAGATGACTGG + Intergenic
902394783 1:16126678-16126700 CAGACCACGGTGAAGGAGACAGG + Intronic
902978920 1:20109371-20109393 CAGCCCAGGGACAAAGTGACAGG - Intergenic
903186552 1:21632530-21632552 CAGATCAGGGATAAGAACACAGG + Intronic
904537682 1:31210720-31210742 CAGGCCAGGGAAAGGTTGACAGG + Intronic
904831834 1:33310345-33310367 GAGACCAGGGAGAGGAAGACCGG + Intronic
905025467 1:34846521-34846543 CAGAGCAGGGACAGTGAGACAGG + Intronic
906203741 1:43975897-43975919 CAGACCAGAGAAAAGAAGAGAGG - Intronic
906830867 1:49030450-49030472 CATACCAGGGACCAGTATCCTGG - Intronic
907246221 1:53110778-53110800 CAGAGCAGGGGCAAGCAGAGAGG - Intronic
911101096 1:94096372-94096394 CAGACCAGAGACAAGCAAACAGG - Intronic
912323393 1:108735471-108735493 CAGTGCAGGTATAAGTAGACAGG - Intronic
912758577 1:112346019-112346041 CAGCCCAGGTACAAGTGGAAGGG + Intergenic
914970563 1:152305274-152305296 CAGTCCAGGGACAATCAGAGGGG - Exonic
914970715 1:152306246-152306268 CAGTCCAGGGACAATCAGAGGGG - Exonic
914971658 1:152312081-152312103 CAGGCCAGGGACAATCAGAGGGG - Exonic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917555251 1:176079461-176079483 CATACCGGGGACAACTAGATGGG + Intronic
918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG + Intergenic
922932829 1:229403593-229403615 CAGAGGAGGGACAAGTGGAAGGG + Intergenic
924921084 1:248629715-248629737 CAGCCCAGGGACAGACAGACTGG - Intergenic
1065474106 10:26115243-26115265 AAGACCAGAGGCAAGGAGACTGG + Intronic
1066654510 10:37685851-37685873 CAGGCCAGGGAGAGGTGGACAGG + Intergenic
1067547087 10:47200222-47200244 CATCCCAGGGAAAACTAGACAGG + Intergenic
1067978593 10:51055460-51055482 CAGTGCAGGGTCAAATAGACAGG + Intronic
1068083524 10:52347445-52347467 CAGACCAGGCACAAGGAGCAGGG - Intergenic
1070162701 10:73875150-73875172 CAGGCCAGGGGCAAGGATACAGG + Intergenic
1070533687 10:77359595-77359617 CACGCCAGGGACAAGTATAAGGG + Intronic
1070538640 10:77399953-77399975 CACACCTGTGACAATTAGACAGG + Intronic
1070853357 10:79585249-79585271 CAGGCCAGGCACAAGGAGAAGGG + Intergenic
1071279423 10:84086785-84086807 CAGAGCAGGGTCAAGTGGAATGG - Intergenic
1071457362 10:85861333-85861355 GAGGCCAGGGACATGTACACGGG - Intronic
1074492380 10:113950355-113950377 CAGATGATAGACAAGTAGACAGG + Intergenic
1077383797 11:2259687-2259709 CAGAGCTGGGACCTGTAGACGGG - Intergenic
1078762645 11:14263677-14263699 CAGAGCAGGGAAAACTAGAGTGG + Intronic
1080012503 11:27472601-27472623 GAGGCCAGGGACAGGGAGACCGG - Exonic
1083607627 11:63988236-63988258 CAGCCCAGGGTCAGGAAGACAGG - Intronic
1083624826 11:64067120-64067142 CAGGCCAGGGCCAAGTAGGCAGG + Intronic
1083936013 11:65870486-65870508 CAGACCAGGGACACAAAGCCGGG + Intronic
1085169351 11:74435260-74435282 CAGAACAGAGACATGCAGACAGG - Intergenic
1085651735 11:78274376-78274398 CAAACCAGGGACAGGGACACTGG + Intronic
1088428326 11:109729644-109729666 CTGACCAGGGACAGCCAGACTGG + Intergenic
1091752758 12:3032940-3032962 CAGGCCAGGGAGCAGAAGACAGG - Intronic
1094488775 12:30945630-30945652 AAGACAAGGGACATGTAGAAAGG - Intronic
1096262207 12:50099921-50099943 CAGACAAGGGACAGGAAGACAGG - Exonic
1096811465 12:54173055-54173077 AAGGCCAGAGACAAGAAGACGGG + Intronic
1097830877 12:64222852-64222874 CAGACCCGGGAGAACTAGAACGG - Intergenic
1099886485 12:88537459-88537481 GATACCAGGGACAACTAGATAGG + Intronic
1101921743 12:108938664-108938686 CAGATGAGGGCCCAGTAGACAGG - Intronic
1104332322 12:127858393-127858415 CTGACCAGAGACAAGAAGAAGGG + Intergenic
1104960119 12:132484567-132484589 GAGGCCAGGGACAAGCAGCCGGG - Intergenic
1105402097 13:20105045-20105067 CAGACAAGGGAGAAGTGCACGGG + Intergenic
1106237702 13:27878535-27878557 CAGACCTGGGAGATATAGACAGG - Intergenic
1106851628 13:33799754-33799776 GAGGCCAGGGACAATGAGACTGG - Intergenic
1107768054 13:43758467-43758489 CAGAGGAGGGACAAGAAGAGAGG + Intronic
1109339796 13:61041473-61041495 CAGATCTGGCACAACTAGACAGG + Intergenic
1111502456 13:89139454-89139476 CAGTCAAGGGACCAGTAGACTGG - Intergenic
1111905958 13:94256463-94256485 CAGACCAAGAGCAAGGAGACTGG + Intronic
1113156070 13:107323742-107323764 AAGACCAGGGACAAGCACAATGG - Intronic
1120281493 14:82444105-82444127 CAGCCTAGGGACAAGTGGAAAGG + Intergenic
1121357456 14:93227810-93227832 CAGAGAAGGGACTAGTATACGGG - Exonic
1122358155 14:101136617-101136639 CAGAACAAGGCCAAATAGACTGG - Intergenic
1122723269 14:103734280-103734302 CAGACCAGGGCCAGGTAGACGGG - Exonic
1122886177 14:104711412-104711434 CAGATCAGGGACAGGTATCCTGG - Intronic
1124905042 15:33860329-33860351 CCAACCAGGGAGAAGTAGAAAGG + Intronic
1127773900 15:62251090-62251112 CAGACCAGGAAGCGGTAGACAGG + Intergenic
1127998577 15:64170385-64170407 CATTCCAGGGAAAAGGAGACTGG - Exonic
1131383103 15:91980821-91980843 CGGACCTGGGAAAAGTAGGCTGG - Intronic
1131513742 15:93064096-93064118 CAGACCACGGGCAAGTAGGATGG + Intronic
1132832111 16:1933487-1933509 CAGAGCAGGGACTGCTAGACCGG + Intergenic
1133127164 16:3654519-3654541 CAGACAAGAGACAGGGAGACTGG + Intronic
1133386799 16:5376491-5376513 GAGACCAGGGATGAGCAGACAGG + Intergenic
1134357811 16:13500661-13500683 GAGACCAGAGACAAAAAGACAGG + Intergenic
1134447499 16:14342065-14342087 CAGGCCAGGGACAGGTTGATGGG + Intergenic
1135733467 16:24913104-24913126 CAGACCAGAGGAAAGTAAACAGG + Intergenic
1136283800 16:29229898-29229920 AAGACCAGGGACATGTGGGCCGG - Intergenic
1137547383 16:49413914-49413936 CAGACCTCAGACAAGTAGACAGG + Intergenic
1137677188 16:50309502-50309524 CAGTCCAGGGACAAGAACGCTGG - Intronic
1137953361 16:52804879-52804901 GACACCAGGGACTACTAGACGGG + Intergenic
1141158621 16:81613995-81614017 CAGAAGAAGGACAACTAGACAGG + Intronic
1141447254 16:84069057-84069079 CAGACCAGAGACGGGTAGACAGG - Intronic
1142030126 16:87834452-87834474 CAGACCCCGAAGAAGTAGACGGG + Exonic
1142088834 16:88199409-88199431 AAGACCAGGGACATGTGGGCCGG - Intergenic
1142599810 17:1048086-1048108 CAGCCCAGGGACAGGGAGATGGG + Intronic
1144997987 17:19283851-19283873 CAGACCAAGGACAATTTGCCTGG - Intronic
1146652726 17:34616479-34616501 CAGAGCAAGGACATGTAGCCGGG - Intronic
1147426706 17:40349181-40349203 CAGACCAGGAACAACCAGACAGG - Intronic
1148807753 17:50272777-50272799 CAAACCAGGGACAAGGAGAAGGG + Intronic
1149678413 17:58487422-58487444 CAAACCGGGGACGAGTAGAAGGG + Intronic
1151356515 17:73561649-73561671 TAGGCCAGGAACAAGTAGAGTGG + Intronic
1152048811 17:77957573-77957595 CAAGACAGGGACACGTAGACAGG + Intergenic
1155983831 18:32208974-32208996 CAGACCAGAGGAAAGTAGATAGG + Intronic
1156379422 18:36544384-36544406 CAGACCAGAGGCAATTAGACAGG - Intronic
1157049497 18:44145301-44145323 CAGAGCAGGGACAAGCTGAGAGG + Intergenic
1160952269 19:1673504-1673526 CAGACCAGGGAGAGGCTGACTGG - Intergenic
1161076803 19:2289766-2289788 CATAGCAGGGACAGGAAGACGGG + Exonic
1161741879 19:6026124-6026146 CAGAGCAGGGACAGGTTGCCAGG + Intronic
1162606370 19:11711410-11711432 CATACTGGGGACTAGTAGACGGG - Intergenic
1164394225 19:27849995-27850017 CAGACCTGGAAGAAGTAGATTGG - Intergenic
1165112164 19:33508769-33508791 CAGACCTGGGACAGGCAGAAGGG + Intronic
1166226883 19:41401517-41401539 CAGAGCAGGGGCAAGAAGTCGGG - Intronic
1167598429 19:50439519-50439541 CAGCCCAGGACCTAGTAGACGGG - Intronic
1167598441 19:50439593-50439615 CAGCCCAGGACCTAGTAGACGGG - Intronic
1167598453 19:50439667-50439689 CAGCCCAGGACCTAGTAGACGGG - Intronic
926704426 2:15826615-15826637 CAGCCCAGGGAGAGGTGGACAGG + Intergenic
927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG + Intergenic
928432932 2:31235050-31235072 CAGCCAAGGGCCAAGTAGAGTGG - Intronic
935678202 2:105614223-105614245 CAAACCAGGCACACGTAGACAGG + Intergenic
936877920 2:117214647-117214669 GAGATCACAGACAAGTAGACAGG + Intergenic
937226716 2:120374570-120374592 CAGACTAGGAACCAGAAGACCGG - Intergenic
941117295 2:161486984-161487006 AAGACCAGGGACATATATACTGG + Intronic
942144919 2:173017696-173017718 CAAATCAGGGAAAGGTAGACAGG - Intronic
942208534 2:173647755-173647777 AAAAAAAGGGACAAGTAGACAGG + Intergenic
942616989 2:177801966-177801988 CTGACCAGGGACTAGTATCCAGG + Intronic
944605209 2:201346426-201346448 CAGAGCAGGGACCAGTGGCCTGG + Intronic
946321362 2:218956264-218956286 CAGATTAGGGAGAAGCAGACAGG + Intergenic
948130401 2:235596524-235596546 CAGACCAGGGACCAGCAGCCGGG - Intronic
1173062449 20:39675298-39675320 CAAACCAGGAACAAGTTCACAGG - Intergenic
1173131803 20:40400783-40400805 GACACCAGGGACAACTAGAGGGG - Intergenic
1173228658 20:41177194-41177216 CAGACCAGGGACAAGTAGACTGG + Intronic
1174483999 20:50850083-50850105 GAGACCAGGGAGAAGTAGAGCGG + Intronic
1179513838 21:41892784-41892806 CAGGCCAGGGCCAAGGACACAGG + Intronic
1179798404 21:43798939-43798961 GAGACCAGGGAGAAGCATACAGG - Intronic
1181955651 22:26586201-26586223 CAGCCTAGGGACATGGAGACGGG - Intronic
1182387194 22:29954384-29954406 CAGATAAGGGCCATGTAGACAGG - Intronic
1183712233 22:39511951-39511973 CTGAACAGGGACATGAAGACGGG + Exonic
1183719261 22:39552841-39552863 GAGACCAGGGACACGCAGAGGGG - Intergenic
950740066 3:15043741-15043763 GAGACCAGGACCAAGTAGTCAGG - Exonic
951556900 3:23930014-23930036 CACTCCAGGGACAACTAGAAAGG + Intronic
954433906 3:50485895-50485917 CAGACCAGGGGCACGGGGACAGG + Intronic
955568184 3:60272340-60272362 TAGACCAGGGACACATAGGCTGG + Intronic
959196779 3:103193253-103193275 TAGACAAGGGGCATGTAGACAGG + Intergenic
960184317 3:114619823-114619845 AAGAGCAGGGGCAAGAAGACTGG - Intronic
960895395 3:122499463-122499485 CAGACAAGGGACGGGTAGAGTGG + Intronic
962038774 3:131683169-131683191 AAGGACAGGGACAAGTAGAGGGG - Intronic
963793605 3:149609200-149609222 CAGGGCAGGGACAAGAACACTGG + Intronic
965459325 3:168942383-168942405 TAGACCAGGGACTACTAGATGGG + Intergenic
978373239 4:108050318-108050340 CAGTGAAGGGACAAGAAGACTGG + Intronic
978373341 4:108050939-108050961 CAGTGAAGGGACAAGAAGACTGG - Intronic
995566348 5:113435582-113435604 CAGAGCAGGGCCAAGAAGAGTGG + Intronic
996655992 5:125937185-125937207 AAGACCAAGGACAAGAAAACAGG - Intergenic
998226693 5:140332607-140332629 CAGAGCTGGGACTAGTAGTCTGG - Intergenic
1002862384 6:1091637-1091659 CAGACCAGGGAAAAGGGGAAAGG - Intergenic
1011743020 6:90382135-90382157 TAAACCAGGGAAAAGGAGACTGG + Intergenic
1012716610 6:102681132-102681154 ATGACCAGGGACAAGTAGCTAGG - Intergenic
1013437570 6:110126831-110126853 CAGATTAGGGAGAAGGAGACAGG - Intronic
1015421359 6:133013162-133013184 CAGACCCGGGACAAAAAGGCAGG + Intergenic
1017846760 6:158265231-158265253 CAGACCAGGAATCAGAAGACAGG - Intronic
1017952531 6:159148312-159148334 CAGAGCTGGGACAAGAAGGCAGG + Intergenic
1018104122 6:160466886-160466908 CACTCCAGGGACAAGTCCACGGG - Intergenic
1025029583 7:55546245-55546267 CAGTCGAGGGAGATGTAGACAGG + Intronic
1026656274 7:72259394-72259416 GAGACCAGGGACAGGGAGTCTGG - Intronic
1028869768 7:95756799-95756821 CAGAAAAGGGACAGGTAGTCAGG - Intergenic
1029686466 7:102151787-102151809 CAGACCAGGACCAAGGAGGCGGG - Intronic
1030638276 7:111974648-111974670 GAGACCAGGGGGAAGTAGGCAGG + Intronic
1032097263 7:128945842-128945864 CAGGCCTGGGCCAAGGAGACAGG + Exonic
1032183096 7:129698617-129698639 CAGACCAGGGCCTAGTGGATGGG + Intronic
1034815906 7:154171689-154171711 CAGCCCAGGGCCACGTGGACAGG + Intronic
1034920245 7:155073588-155073610 CAGACCAGGAACAAGAAGACTGG + Intronic
1036521422 8:9494865-9494887 AAGGCCAGGGACAAGAACACTGG - Intergenic
1037424420 8:18740162-18740184 CAGACCTGGGAACAGAAGACAGG - Intronic
1038151763 8:24947859-24947881 CAGACCGTGAACAAGTAAACAGG - Intergenic
1042175506 8:66034087-66034109 CACACCTGGGACAGGTAGGCAGG - Intronic
1042391541 8:68241330-68241352 CAGATTAGGGAGAAGGAGACAGG + Intergenic
1042863904 8:73340042-73340064 CAGATGAGAGACAAGTATACAGG + Intergenic
1044580463 8:93821026-93821048 AAGTCCAGGGACAAGTCCACGGG + Intergenic
1052692518 9:31833474-31833496 CATACCAGGGACTAGCAGAGTGG - Intergenic
1053471385 9:38348112-38348134 CAGAGCAGGGCCAAGCACACAGG + Intergenic
1057446733 9:95121320-95121342 CAGAACAGGGACAAGAGGAAAGG + Intronic
1059420406 9:114187003-114187025 CAGACCAGAGACAAGGTGGCTGG - Intronic
1061064039 9:128266382-128266404 CAGACCAGGAACGGGTAGGCAGG + Intronic
1061622963 9:131823725-131823747 CAGACCTGGGACAGGGAGATGGG - Intergenic
1186799544 X:13079181-13079203 CAGACCAGGCACATGCAGAGTGG + Intergenic
1187745825 X:22408283-22408305 CATATGAGGGACAAGAAGACGGG - Intergenic
1189852570 X:45192067-45192089 GAGCCCAGGGACAGGAAGACAGG + Intronic
1191699340 X:64022766-64022788 AAGACCAGAAACAAGGAGACAGG + Intergenic
1192198355 X:69047385-69047407 CAGACCAGGGTCAGGTGGATGGG - Intergenic
1198685053 X:139219994-139220016 CAGATCTGGGACATGCAGACAGG + Intronic
1199490872 X:148399126-148399148 CAGACCAGGGAAAGGTATAGGGG - Intergenic
1199983306 X:152933015-152933037 CAGACCAGGGTCAAGCTGCCAGG + Intronic
1200812712 Y:7502010-7502032 CAGCCCAGGGACAAGGGGAGAGG - Intergenic