ID: 1173228846

View in Genome Browser
Species Human (GRCh38)
Location 20:41178561-41178583
Sequence TTTCCTAGATTTTGTATCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 337}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173228846_1173228848 18 Left 1173228846 20:41178561-41178583 CCACAGATACAAAATCTAGGAAA 0: 1
1: 0
2: 2
3: 31
4: 337
Right 1173228848 20:41178602-41178624 GAAATAGCAGCATCCCCACAGGG 0: 1
1: 0
2: 2
3: 11
4: 146
1173228846_1173228847 17 Left 1173228846 20:41178561-41178583 CCACAGATACAAAATCTAGGAAA 0: 1
1: 0
2: 2
3: 31
4: 337
Right 1173228847 20:41178601-41178623 AGAAATAGCAGCATCCCCACAGG 0: 1
1: 0
2: 2
3: 13
4: 155
1173228846_1173228850 30 Left 1173228846 20:41178561-41178583 CCACAGATACAAAATCTAGGAAA 0: 1
1: 0
2: 2
3: 31
4: 337
Right 1173228850 20:41178614-41178636 TCCCCACAGGGGACCTCGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 127
1173228846_1173228849 19 Left 1173228846 20:41178561-41178583 CCACAGATACAAAATCTAGGAAA 0: 1
1: 0
2: 2
3: 31
4: 337
Right 1173228849 20:41178603-41178625 AAATAGCAGCATCCCCACAGGGG 0: 1
1: 0
2: 0
3: 15
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173228846 Original CRISPR TTTCCTAGATTTTGTATCTG TGG (reversed) Exonic
904514753 1:31045741-31045763 TTTACTAGATTTAGTAGATGTGG - Intronic
905321016 1:37117394-37117416 TTATCTACATTTTGTAGCTGAGG + Intergenic
905883792 1:41481019-41481041 TTTCCCATATTTTCTATGTGAGG - Intronic
906561218 1:46758448-46758470 TTTCTTAAATTGTATATCTGAGG + Intronic
907387797 1:54137221-54137243 TTTCCTCATTTTTGTATTTGTGG - Intronic
909366758 1:74833575-74833597 TTTTCTACATGTTGTATCTCTGG + Intergenic
910178856 1:84459731-84459753 TTTTATAGATTAGGTATCTGAGG - Intergenic
910945231 1:92584125-92584147 TTTGTTAGATTTTTCATCTGTGG - Intronic
912184613 1:107260368-107260390 GTCCCTACATTTTGTTTCTGTGG - Intronic
912829382 1:112938372-112938394 TTTCCTAGACTTTGAATCTTGGG - Intronic
914454827 1:147826149-147826171 TTTCCTAAATTTTGTAATTTAGG + Intergenic
914694249 1:150061577-150061599 TTTCCAAGATTTCCTATGTGCGG - Intergenic
916056216 1:161070271-161070293 TTTCCTAGGTTTGGAAACTGAGG - Intergenic
917087316 1:171316916-171316938 TCTCTTAGATTTTGTGCCTGGGG + Intronic
917956842 1:180108285-180108307 TTTCCTAAATTTTGTTATTGTGG + Intronic
918121944 1:181548040-181548062 TTGCCTTAATTTTCTATCTGAGG + Intronic
918439073 1:184547516-184547538 TTTCCTAGATTTCCTCCCTGTGG - Intronic
918587404 1:186203711-186203733 TTCCCTAGATTTTGGACCTTGGG - Intergenic
920664101 1:207947494-207947516 TTTCCAATATTTTGCATTTGGGG + Intergenic
920925223 1:210334879-210334901 TTTTCTAGTTTTTGTGTCTTTGG - Intronic
921664006 1:217844715-217844737 ATTCCTAGATTTTGTATTAATGG - Intronic
921851285 1:219934507-219934529 GTTCCTATATTTTGTATATGTGG - Intronic
1063705923 10:8430744-8430766 TTTTCCAGATTTTGTATTTCAGG + Intergenic
1063723794 10:8614613-8614635 TTTCCTAGATTTAGAATATAGGG + Intergenic
1065057416 10:21860917-21860939 TCTCATTGAATTTGTATCTGTGG - Intronic
1065792791 10:29276888-29276910 TGTACCAGATTTTGTATTTGTGG - Intergenic
1065836063 10:29659589-29659611 TTTCCTAGAAGTTGCCTCTGGGG - Intronic
1066797231 10:39136059-39136081 TTTTCTAGTTTTTTTTTCTGGGG - Intergenic
1067000109 10:42602963-42602985 TTTCCTAGAATTTGAAGCTGTGG - Intronic
1068509222 10:57942724-57942746 TTTCCTTCATTTTGTTTCTTGGG - Intergenic
1068760495 10:60703028-60703050 TTTTCTGGATTTTGTATTTCAGG - Intronic
1071699703 10:87917087-87917109 TTTCAAAAATTTTATATCTGAGG + Intronic
1071919043 10:90328940-90328962 TTTCCTATATTTCCTTTCTGTGG - Intergenic
1071963983 10:90833643-90833665 TTTCCTTCATTTTGTCTCTGGGG + Intronic
1071974194 10:90938660-90938682 TGTCCTAGTTTTGGTATCTGGGG + Intergenic
1072319672 10:94236450-94236472 TTTCCTAGTTTTTGTAACAGTGG + Intronic
1072610272 10:97013324-97013346 TTTTGTGGATTTTGTAACTGGGG + Intronic
1072792832 10:98330989-98331011 TTTCCTAAATCCTGTTTCTGAGG + Intergenic
1074021144 10:109585045-109585067 TTTTCTAGATTTCATATCAGTGG - Intergenic
1076433964 10:130426933-130426955 TGTCTTATATTTTGTACCTGTGG + Intergenic
1077618330 11:3695885-3695907 TTTCCTCCATTTTGTAGCTGAGG - Intronic
1077762020 11:5111997-5112019 TTGCCTAGATTTTGTAGTTTTGG + Intergenic
1078293390 11:10039499-10039521 TTTCCAAGATTTTGAAAATGCGG - Intronic
1078984791 11:16582648-16582670 TTTCTTCTTTTTTGTATCTGTGG - Intronic
1079602994 11:22333148-22333170 TTTCTTAGAAATTGTCTCTGAGG + Intergenic
1079728197 11:23903968-23903990 TTTATTATATTTTATATCTGAGG + Intergenic
1079784698 11:24657052-24657074 TTTCCAGGATATAGTATCTGAGG - Intronic
1081009072 11:37785167-37785189 TTGCCTAGATTTTTTTTCTAGGG - Intergenic
1081329007 11:41781126-41781148 TTTTTGAGATTTTGTATTTGGGG + Intergenic
1085634707 11:78149533-78149555 TTTCCTATATTTTGTTATTGGGG + Intergenic
1086010784 11:82100920-82100942 TTTCCTCTATTTTGCACCTGTGG - Intergenic
1086344885 11:85886005-85886027 TTGCTTAGATTTTGAATCAGGGG + Intronic
1086396272 11:86418875-86418897 TTTCGTAGATTTTTTTTTTGTGG - Intronic
1086773258 11:90796026-90796048 TTTCCTGCATTTCGTTTCTGTGG + Intergenic
1086904473 11:92403238-92403260 TTACATTGATTTTGTATTTGAGG + Intronic
1087930082 11:103967058-103967080 TTTCATAGCTTTTATATTTGGGG - Intronic
1088157659 11:106828292-106828314 TTTCCTAGATTTTTTTTTTAAGG + Intronic
1089869358 11:121658295-121658317 TTTTTAATATTTTGTATCTGAGG - Intergenic
1090302733 11:125659899-125659921 TAACCTACATTTTGTCTCTGTGG + Intronic
1091423088 12:360372-360394 TTCCCTTTATTTTGTATCTTTGG - Intronic
1091646051 12:2273331-2273353 TTTCAAATATTTTCTATCTGTGG + Intronic
1091660294 12:2378240-2378262 TTTTCTAGCTTGTGTTTCTGGGG - Intronic
1093061233 12:14608044-14608066 TATCCTTGATTTTGTTACTGTGG + Intergenic
1093864714 12:24211240-24211262 TTCCCTAGACAGTGTATCTGAGG + Intergenic
1094116057 12:26914509-26914531 TTCCATCGATTTTATATCTGGGG + Exonic
1094138858 12:27159700-27159722 TTTCCTAGATTTTTTTTCTGGGG - Intergenic
1095044128 12:37480926-37480948 TTTTCAATATTTTGCATCTGAGG - Intergenic
1097578429 12:61423663-61423685 TTTTGTAGATTTTGTTTCTCAGG + Intergenic
1098170401 12:67741184-67741206 TTTCAAAGATTATGTTTCTGAGG - Intergenic
1098201124 12:68056865-68056887 TTTCCTAGGTTTTCTTTTTGGGG + Intergenic
1098839541 12:75462213-75462235 TTGCCTAGATTTTTTTTCTAGGG + Intergenic
1099280026 12:80632024-80632046 TCTCCTAGATTTTTTAACTTTGG - Intronic
1099790074 12:87322503-87322525 TTTCCTAATCTTTGAATCTGGGG + Intergenic
1101407249 12:104439372-104439394 TTTCCTGCCTTTTGTTTCTGCGG + Intergenic
1101927129 12:108981423-108981445 TCTCTTAGATTTGGAATCTGAGG + Intronic
1103124177 12:118407236-118407258 TTTAATAGATTTGGTATCTAGGG + Intronic
1104246468 12:127046895-127046917 TTTCCTTCATTTTGCATATGAGG - Intergenic
1107217956 13:37944651-37944673 TTTCCAAGCCTTTGTTTCTGTGG + Intergenic
1107586418 13:41853287-41853309 TTTATTATGTTTTGTATCTGTGG + Intronic
1108915291 13:55602865-55602887 TTTACTAGCTTTTTTATCTTAGG - Intergenic
1109151346 13:58852176-58852198 TTTTCTAGATTTTCTCTTTGTGG - Intergenic
1109178261 13:59181781-59181803 TTTCCTTGATGTTGTTTGTGGGG + Intergenic
1109437184 13:62319251-62319273 TTTTGTAGATTTTGTATTTTGGG + Intergenic
1110087358 13:71397848-71397870 TTTCCTATTTTTTGTGTGTGTGG - Intergenic
1110274174 13:73624854-73624876 TTTCCTACATTTGGTATATTTGG - Intergenic
1111430272 13:88140602-88140624 TGTCCTACTCTTTGTATCTGTGG + Intergenic
1111571462 13:90092722-90092744 TTTCCTTGATCTTGTATTTGTGG - Intergenic
1112106476 13:96245866-96245888 TTTCCTAGATTTTGAGAATGTGG + Intronic
1112675558 13:101697330-101697352 CTTCCTAGGTTTTGTTTCTGAGG + Intronic
1112956355 13:105063699-105063721 TTTCCAAGATTCTGATTCTGAGG - Intergenic
1113216379 13:108045460-108045482 ATTCCTAAATCTTGTATCAGAGG + Intergenic
1113260095 13:108552229-108552251 TTTCTTGGATTGTGTATATGTGG + Intergenic
1113783728 13:112990996-112991018 TTTCTTTGTTTTTGTCTCTGTGG - Intronic
1115134580 14:30093585-30093607 ATTCCTAGATATTTTATTTGTGG - Intronic
1115397654 14:32926863-32926885 TCTCCTAGTTTTTATTTCTGCGG - Intergenic
1115633962 14:35273062-35273084 TTTCATATATTTTCAATCTGTGG + Intronic
1117999801 14:61512318-61512340 TTTCCTGGATTTTCTCTCTGAGG - Intronic
1118308009 14:64672077-64672099 TTTTCAATATTTTCTATCTGTGG - Intergenic
1118707962 14:68497195-68497217 TTCCCAATATTTTGTTTCTGTGG - Intronic
1119594007 14:75917264-75917286 TTTTCTCGATTTTGCATTTGAGG + Intronic
1120015785 14:79471758-79471780 TGTCCTAGATTGAGTAACTGGGG + Intronic
1121648940 14:95542120-95542142 TTTGATAGACTTTGTATTTGAGG + Intronic
1202942674 14_KI270725v1_random:168589-168611 TTTTCAAGATTTTGCATCTGAGG - Intergenic
1125339282 15:38658709-38658731 TTTCATAGAATTTGGATTTGAGG - Intergenic
1125926322 15:43566250-43566272 TTTCTTAGAATTTATATGTGTGG - Intronic
1125939466 15:43665800-43665822 TTTCTTAGAATTTATATGTGTGG - Intronic
1126290781 15:47075172-47075194 CTTTCAAGATTTTGCATCTGAGG + Intergenic
1126433649 15:48613328-48613350 TGTGCTACATTTTGTATCTCTGG - Intronic
1126498957 15:49323259-49323281 TTTGCTAGAGGTTGTGTCTGTGG - Intronic
1127069997 15:55279581-55279603 TTTTACAGATTTGGTATCTGAGG - Intronic
1127539614 15:59923760-59923782 TTTCCTCCATTTTATAGCTGAGG - Intergenic
1129676307 15:77633810-77633832 TGGCCTAGTTTCTGTATCTGAGG - Intronic
1131867165 15:96723434-96723456 TTTCCTTAATTTGGTATTTGTGG - Intergenic
1132610130 16:811712-811734 TTGCCTAGAAATTGTATCTAAGG + Intronic
1133632208 16:7631764-7631786 TTTCCTAAATTGTGAAGCTGAGG + Intronic
1136074384 16:27806817-27806839 TTGCCTAGACTTTGCATATGAGG - Intronic
1136704618 16:32176331-32176353 TTTAATAGAATTTGTATGTGTGG - Intergenic
1136763295 16:32753075-32753097 TTTAATAGAATTTGTATGTGTGG + Intergenic
1136804805 16:33117311-33117333 TTTAATAGAATTTGTATGTGTGG - Intergenic
1137759972 16:50932812-50932834 TTTCTTTTCTTTTGTATCTGAGG + Intergenic
1138154535 16:54691083-54691105 ATTCCTAGATGTTGAAGCTGAGG - Intergenic
1141283154 16:82647144-82647166 TTTCATAGATCTGGTAACTGAGG - Intronic
1141304185 16:82845556-82845578 TTTCCCATCTTTTGTCTCTGTGG + Intronic
1141406650 16:83800400-83800422 TTTCTTAAAATTTTTATCTGGGG - Intronic
1141641703 16:85345242-85345264 TTTCATATAATTTTTATCTGTGG - Intergenic
1203065446 16_KI270728v1_random:1013397-1013419 TTTAATAGAATTTGTATGTGTGG + Intergenic
1142757700 17:2025453-2025475 TTTCATAAATTTTGTATGGGAGG - Intergenic
1143824057 17:9589984-9590006 TTTCCTTGGTCTTGGATCTGTGG + Intronic
1144084146 17:11793438-11793460 TTTCCTAGCTATTGTACCTCTGG + Intronic
1144961476 17:19046661-19046683 TTTCCTAGATGGAGAATCTGAGG + Intronic
1144973684 17:19127863-19127885 TTTCCTAGATGGAGAATCTGAGG - Intronic
1147941275 17:44050051-44050073 TTCCCTATGTTTTGAATCTGGGG + Intronic
1149005550 17:51801604-51801626 CTTTCTAGATTTCGTTTCTGAGG - Intronic
1150324471 17:64245524-64245546 AATCCTCGATTTTGTATCTATGG - Intronic
1151411341 17:73932194-73932216 TTTCCTAGAGTTTGTGTGAGTGG + Intergenic
1152996051 18:407186-407208 TTTCTTTGATTTTGTCTCTAGGG + Intronic
1153196677 18:2606611-2606633 TATCCTATAATTTGTATCTTGGG + Intronic
1153536613 18:6108764-6108786 TTTCAAAGATTTTTTATCTGTGG - Intronic
1153801813 18:8677870-8677892 TTTTCTACATTTTATATCTGTGG - Intergenic
1155471933 18:26200706-26200728 TTTCCTAGATTTTGGCTTAGAGG - Intergenic
1155653241 18:28165929-28165951 TCCCCTGGATTTTGTATATGTGG - Intronic
1155760311 18:29557065-29557087 TTTTCTAGATTCTGTATTTTTGG - Intergenic
1155800546 18:30097295-30097317 TTTCCTAGATTTAGCACTTGAGG - Intergenic
1156095115 18:33521314-33521336 TTTCCAAGATTTTAATTCTGTGG - Intergenic
1156272147 18:35545484-35545506 TTTCCTTGATTTGGGGTCTGAGG - Intergenic
1156415363 18:36882692-36882714 TTTTCTAAATTTAGTTTCTGGGG - Intronic
1156439852 18:37173917-37173939 TTTCCTAGGTTTGGCTTCTGTGG - Intronic
1156616959 18:38798653-38798675 TTTTCCACATTTTATATCTGAGG + Intergenic
1156798780 18:41082166-41082188 TTTTCTTTTTTTTGTATCTGAGG - Intergenic
1158898876 18:61942322-61942344 TTTACTACATTTTGTATTTGTGG + Intergenic
1159037395 18:63290817-63290839 TTCTCTTGTTTTTGTATCTGTGG - Intronic
1159370603 18:67523111-67523133 TTTCCGAGAATTTGGATTTGAGG - Intergenic
1163555353 19:17989112-17989134 TTTCCCTGATTTTCTATATGGGG - Intronic
1164677056 19:30107953-30107975 TTTCCTTGATTTTCTTTCTTTGG + Intergenic
1165618516 19:37224123-37224145 TTTCCTAGATTTTAATTTTGGGG - Intronic
1167976223 19:53228350-53228372 ATTCCCACATTTTGTATCTCAGG + Intergenic
925132638 2:1504371-1504393 TTTCATAGGTTTTTTGTCTGGGG - Intronic
926532159 2:14062049-14062071 TTTGCTAGGTTTCCTATCTGGGG + Intergenic
926759680 2:16267025-16267047 TTTCTAATATTTTCTATCTGTGG - Intergenic
927410257 2:22816884-22816906 TTTCCTAGGTTTTGTTTCTTTGG - Intergenic
927590514 2:24353228-24353250 TTTCGTAGATTATTTATTTGAGG - Intronic
928250888 2:29677761-29677783 TTTCCTAGATTTAGGATCAGGGG + Intronic
929644272 2:43611399-43611421 TTTCCAAGGTGCTGTATCTGGGG - Intergenic
930427270 2:51228063-51228085 TTTCCTGGCATTTGTATCTCAGG + Intergenic
931848320 2:66228000-66228022 TATCCTACACTTTGTATTTGAGG + Intergenic
932266248 2:70369418-70369440 CTTCAAAGATTTTGTATGTGTGG + Intergenic
932519054 2:72389226-72389248 TTTTATACATTTAGTATCTGAGG + Intronic
933287956 2:80404919-80404941 TTTACTGAATTTTTTATCTGGGG - Intronic
934785916 2:97005653-97005675 TTCCAGAGATTTTGTTTCTGAGG - Intronic
934906552 2:98210061-98210083 TTTCCTGTATTTTTAATCTGTGG - Intronic
935049835 2:99515515-99515537 TTTCCAAATTTTTTTATCTGAGG - Intergenic
935078020 2:99764960-99764982 TTTCCCAAATTCTGAATCTGGGG + Intronic
936991376 2:118370254-118370276 TTTCCTCCATTTTTTTTCTGTGG - Intergenic
937137117 2:119563357-119563379 TTTCATATATTTTTGATCTGTGG + Intronic
938585617 2:132687464-132687486 TTTGCTAGATTTAGTGTGTGCGG + Intronic
938837424 2:135120577-135120599 TTTCCTAAATTTTGCATCTTTGG + Intronic
938865334 2:135413731-135413753 TTCCACAGGTTTTGTATCTGTGG + Intronic
939242441 2:139578577-139578599 TTTCCTAGATTTTTTTTCTGGGG - Intergenic
940984694 2:160040965-160040987 TTACCTACATTTTATGTCTGAGG + Intronic
941157315 2:161995472-161995494 TTTGCTATATTTTGTATCAAAGG - Intronic
942656346 2:178217969-178217991 CTTCCTAACTTTTGTATCAGTGG + Intronic
943115742 2:183667905-183667927 TTTTCAATATTTTTTATCTGTGG + Intergenic
944139738 2:196442996-196443018 TTTCCTTTATTTTGATTCTGTGG - Intronic
945143107 2:206708418-206708440 CTTGCTAGATTTCTTATCTGAGG - Intronic
945309528 2:208294984-208295006 TCACCTAGAATTTGTATCTCTGG + Intronic
945387489 2:209220251-209220273 TTTCTTAGATTTTGTAATTCTGG - Intergenic
945463830 2:210144026-210144048 TTTCTCAGATTTTGTATGTCTGG + Intronic
945799525 2:214410180-214410202 TTTGCTAGATCTTAAATCTGGGG + Exonic
945900454 2:215532043-215532065 CTTACTAGATTTTTTAACTGTGG + Intergenic
1168734524 20:118951-118973 TTTTCTAGGTTTTGTATCAAAGG + Intergenic
1168777517 20:460825-460847 TTTCCTTGATTTTGCTTCTCTGG - Intronic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1170934801 20:20800298-20800320 TTACCAAGATTTTGCCTCTGTGG + Intergenic
1171538669 20:25924551-25924573 TTTTCAAGATTTTGCATCTGAGG - Intergenic
1171802363 20:29635730-29635752 TTTTCAAGATTTTGCATCTGAGG + Intergenic
1173228846 20:41178561-41178583 TTTCCTAGATTTTGTATCTGTGG - Exonic
1173569272 20:44066237-44066259 CTTCCTAGATGTGGTAACTGAGG - Intronic
1175019668 20:55831249-55831271 TTACCTACATTTTATATATGAGG - Intergenic
1175457044 20:59123454-59123476 TTTCCAAGCCTTTGTTTCTGTGG + Intergenic
1175662825 20:60831549-60831571 TTTCGTGGTTTTTATATCTGTGG + Intergenic
1175759460 20:61551059-61551081 TTACCTGCATTTTGTATTTGAGG - Intronic
1181445112 22:22965020-22965042 ATTCCTAGGTATTGTATTTGTGG + Intergenic
1181839958 22:25648381-25648403 TTTGCTAGACCTTGAATCTGAGG - Intronic
1181933285 22:26420326-26420348 TTTCCTAGAATTTGTGACTCAGG + Intergenic
1182387076 22:29953325-29953347 CTTACTAGTTTTTGTAGCTGGGG + Intronic
949142992 3:657893-657915 TTTTATAGATTTGGTAACTGAGG - Intergenic
950569060 3:13788791-13788813 TTTCCTGGATTTTGTCCTTGGGG + Intergenic
953080472 3:39612000-39612022 TTTCCTCTATATTGTCTCTGCGG + Intergenic
954055575 3:48021192-48021214 TTTACTAGATGTAGAATCTGAGG + Intronic
954269157 3:49493977-49493999 TTTTTTAGAATTTGTAGCTGTGG + Intronic
957479064 3:80768218-80768240 TTTCCTATATTTTGCTTTTGGGG + Intergenic
958186569 3:90128395-90128417 TTTCTTAAACTATGTATCTGTGG + Intergenic
958566186 3:95814182-95814204 TTACCTAGATTTTGTAAGTCTGG + Intergenic
958818242 3:98942227-98942249 TTTCCTTCTTTTTATATCTGAGG + Intergenic
958876048 3:99618478-99618500 TTCCCTAGTTTTTGAATCTAAGG - Intergenic
959555030 3:107707092-107707114 TTTTCTTGATTTTTCATCTGAGG + Intronic
960033348 3:113077817-113077839 TTTCAAATATTTTTTATCTGTGG + Intergenic
960312463 3:116133173-116133195 TTTCCTAGGTTGTGCACCTGAGG - Intronic
960657291 3:120019547-120019569 TTTCCTATCTTTTTTACCTGAGG + Intronic
961595206 3:128010377-128010399 TTTCCTAGAATTTGACTTTGAGG - Intergenic
962637755 3:137348392-137348414 TGTCCTAGAGTTTGCTTCTGGGG + Intergenic
964052467 3:152412536-152412558 TCTCCTACATTTTTTATCTATGG - Intronic
964164607 3:153687246-153687268 TTTATTAGATTATGTATCTTGGG - Intergenic
964704350 3:159602286-159602308 TCTCCTAGATGTTCTATTTGAGG + Intronic
965529975 3:169761764-169761786 ATTCATAGATTCTGTATTTGTGG + Intergenic
965712957 3:171574792-171574814 ATTCATAGATTTTGTATCTCTGG + Intergenic
965954615 3:174354181-174354203 TTTCCTACATTTTGTATATTAGG - Intergenic
965954631 3:174354465-174354487 TTTTCTACATTTTGTATATTAGG - Intergenic
967525215 3:190484908-190484930 CTTGATAGATTTTGTATCTTTGG - Intergenic
969977509 4:11119141-11119163 CTTTCTAAATATTGTATCTGAGG - Intergenic
970705297 4:18794391-18794413 GTTCCTACATTTCCTATCTGGGG - Intergenic
970994601 4:22250892-22250914 TTTCCAAGATTTTAAAGCTGAGG - Intergenic
971021803 4:22544665-22544687 TTTCCTTGGCTTTGTATATGTGG + Intergenic
971063647 4:23002097-23002119 TTTCCTGCATTTTCCATCTGAGG + Intergenic
971297092 4:25405108-25405130 TTTCTTTGATCTAGTATCTGTGG - Intronic
971547305 4:27902582-27902604 TCTCCTAAATATTTTATCTGAGG - Intergenic
971657453 4:29368188-29368210 TTTCCAAGTTTTTGTAACAGAGG - Intergenic
971861588 4:32112816-32112838 TTTCCCAGATTTTGGAAATGAGG + Intergenic
972941656 4:44202756-44202778 TTGTTTAGATTTTGTATTTGGGG - Intronic
973899652 4:55455557-55455579 TTTCCTAAATTTTGATTTTGAGG - Intronic
974074370 4:57155278-57155300 TTTCTTATATTTAGTACCTGGGG + Intergenic
974223859 4:59012959-59012981 TCTACTAGTTTTTGTATGTGTGG + Intergenic
974288703 4:59903579-59903601 TTTCCTTGGTTTTGTTTCTATGG - Intergenic
974514094 4:62885752-62885774 TTTTCTAGCTTTGTTATCTGGGG - Intergenic
974556301 4:63453177-63453199 TTTCCTAGATGATGAAACTGAGG + Intergenic
974687118 4:65244372-65244394 TTTCATAGATTCAGTATCTTAGG + Intergenic
974832605 4:67207847-67207869 TGCCCTAAATTTTGTTTCTGGGG + Intergenic
975096331 4:70461179-70461201 TCTCCTAGATGTTCTATTTGAGG + Intronic
975176187 4:71291885-71291907 TCTCCTAGTTTTTATTTCTGTGG + Intronic
975364631 4:73514953-73514975 TTTCCTGGTTTTGGTATCTGGGG + Intergenic
978519634 4:109602927-109602949 ATTCCTAGATATTTTATCTGTGG + Intronic
978721131 4:111910807-111910829 TGTTCTTGATTTTATATCTGAGG - Intergenic
979708012 4:123744645-123744667 TTTACAAGATTTTGTGTGTGTGG + Intergenic
979796142 4:124849039-124849061 TTACCTACATTTTATATATGTGG + Intergenic
980047009 4:128000219-128000241 TTTCCTAGGTTTTTCTTCTGGGG + Intronic
980465796 4:133178937-133178959 TTTCCTAAATTTTGTTGCTGTGG + Intronic
981877816 4:149569300-149569322 TTTCAAAGATTTTGTTTCAGAGG + Intergenic
983336015 4:166393539-166393561 TTCCCTATATTTTGAATATGTGG + Intergenic
984308425 4:178024795-178024817 TTTCCTATATTTTTGATCTTTGG - Intergenic
985833656 5:2254553-2254575 TTTCCTCGATTCTCTCTCTGAGG + Intergenic
986995775 5:13605471-13605493 TTTCCTAGTTTTTATTTTTGTGG - Intergenic
987308823 5:16663526-16663548 TTTCAAATATTTTCTATCTGTGG - Intronic
989137085 5:38166636-38166658 TATTCTAGATTTTATATTTGTGG - Intergenic
989509998 5:42275270-42275292 TTTAGTTGATTTTGTATTTGTGG - Intergenic
991404126 5:66285274-66285296 TATCCTAGACTTTGTAACAGTGG + Intergenic
991907930 5:71530730-71530752 TTCTCTAAATTTTGTATCTGAGG + Intronic
994904019 5:105813311-105813333 TTTGCTATATTTTGTATATTAGG - Intergenic
995337351 5:111014937-111014959 TTTCCTATAATTTGAATCTTTGG + Intergenic
995672414 5:114621611-114621633 TTTCCTAGATTATCTGTATGAGG - Intergenic
995716284 5:115084518-115084540 TTTCCTTCTTTTTCTATCTGTGG - Intergenic
996708466 5:126520740-126520762 TCTCCTAGATTTAGTGTCTGGGG - Intergenic
996949351 5:129107481-129107503 TTTCTGATATTTTCTATCTGTGG - Intronic
998611954 5:143699035-143699057 TTTCCTAGAATTTCTACCAGTGG - Intergenic
999579202 5:153015754-153015776 TCTCCCAGATTTTGTATATATGG - Intergenic
999681194 5:154061915-154061937 TTTTGTAGATTCTGTATCTTAGG + Intronic
1000790436 5:165600355-165600377 TAGACTAGATTTTGTACCTGAGG - Intergenic
1000951938 5:167494826-167494848 TATCCTAGTGTTTTTATCTGGGG - Intronic
1002984413 6:2174897-2174919 TTTCCTATATTTCATATTTGTGG - Intronic
1003630035 6:7778554-7778576 CTTCCTAGACATTGTTTCTGTGG + Intronic
1004843590 6:19614299-19614321 TTTACTAGATATTCTATTTGGGG - Intergenic
1004960581 6:20783877-20783899 ATGCATAGATGTTGTATCTGAGG - Intronic
1007289943 6:40778066-40778088 TTTCCAAGGTTTTCTACCTGGGG + Intergenic
1009357778 6:62773235-62773257 TTTCCTTGTTCTTTTATCTGAGG - Intergenic
1009498225 6:64376839-64376861 TTTCCTATATTTTCTATCTCAGG + Intronic
1009569180 6:65359747-65359769 TTTCTTAGTATTTGTATATGTGG + Intronic
1009603280 6:65832220-65832242 TCTCCTAGGCTTTGTTTCTGAGG - Intergenic
1009865264 6:69390124-69390146 TTTCCTTTAATGTGTATCTGAGG - Intergenic
1010436046 6:75832301-75832323 TTTCCTAGATTATATCTGTGGGG - Intronic
1012341431 6:98130094-98130116 TTTCCTAGAATTTGTGCCTGTGG - Intergenic
1012581955 6:100880846-100880868 ATTCCTAGAGTTTGTAGGTGGGG - Intronic
1013028119 6:106300098-106300120 TTACATAGATTTTATATATGTGG - Intronic
1014198021 6:118580781-118580803 TTTCCTTCCTTTTCTATCTGTGG + Intronic
1015508466 6:134013519-134013541 TTTTCTTTATTTTGTATCTGTGG + Intronic
1015876171 6:137825018-137825040 TTTTTTAGTTTTTGTATCTATGG + Intergenic
1016729247 6:147409765-147409787 ATACTTAGATTTTGTAACTGGGG - Intergenic
1017263051 6:152409915-152409937 GTTCATAGATTTTGTTTCAGTGG - Intronic
1018007656 6:159638248-159638270 TTTTCTAGAACTTGTATCAGTGG - Intergenic
1018205524 6:161434126-161434148 TTTTCAAAATTTTGTATGTGGGG + Intronic
1020504939 7:8974030-8974052 TTTATTAGATTTTGTAGCTCAGG - Intergenic
1021169651 7:17383406-17383428 TTCCAAATATTTTGTATCTGTGG - Intergenic
1021370665 7:19841577-19841599 TTTCCTATATAATATATCTGTGG - Intergenic
1021956222 7:25827146-25827168 ATTCCTAGGTATTTTATCTGTGG - Intergenic
1022836375 7:34119780-34119802 TTTCCTAGATATTCAATTTGAGG - Intronic
1023397417 7:39764040-39764062 CTTCCTAGATGGTGGATCTGAGG - Intergenic
1023491233 7:40744313-40744335 TTTCACAGCCTTTGTATCTGTGG + Intronic
1025135254 7:56406424-56406446 CTTCCTAGATGGTGGATCTGAGG + Intergenic
1025290056 7:57710473-57710495 TTTTCAATATTTTGCATCTGAGG - Intergenic
1026040795 7:66866133-66866155 TTTCCTAGGTGGTGGATCTGAGG - Intergenic
1027551706 7:79605741-79605763 TTTCATAGATGTTGTAAATGAGG - Intergenic
1027582159 7:80011413-80011435 TGTCCTTCATTTTGTTTCTGTGG + Intergenic
1028348756 7:89817157-89817179 TTTTCTATAATTTGGATCTGGGG - Intergenic
1028585279 7:92446327-92446349 TTTCCTAGACTTAGTATCCTTGG - Intergenic
1029370392 7:100146663-100146685 TTTCCTATCTTTTTTATCTATGG - Intergenic
1030180391 7:106701772-106701794 TTTCAAATATTTTCTATCTGTGG - Intergenic
1030488472 7:110202283-110202305 TTTCTTAGCTTTTGTTTCTCTGG + Intergenic
1030697087 7:112597448-112597470 TTTTCAATATTTTTTATCTGTGG - Intergenic
1030741629 7:113116544-113116566 ATTTCTAGATTTTCTATCAGGGG + Intergenic
1031192021 7:118564729-118564751 TTTCTTAGAATATGTCTCTGTGG + Intergenic
1031218955 7:118938615-118938637 TTCCCTACACTATGTATCTGAGG + Intergenic
1031930063 7:127676100-127676122 TATCATAGATTTAGTATTTGGGG + Intronic
1034526561 7:151667297-151667319 CTTCTTAGAGTTTGTATCTGAGG + Intronic
1035754322 8:2020347-2020369 TTTCTTAGATTGTGTATGTAAGG - Intergenic
1037071003 8:14649242-14649264 TTTCCTAGATTTTATTTGTGAGG + Intronic
1040114872 8:43605242-43605264 CTCCCTATATTTTTTATCTGGGG - Intergenic
1041435490 8:57835815-57835837 TTTTTTAGATATTTTATCTGTGG + Intergenic
1042137823 8:65648997-65649019 TTTCAAATATTTTCTATCTGCGG - Intronic
1043083012 8:75789870-75789892 TTTACTAGTTTTTCTATCAGAGG + Intergenic
1043111219 8:76185022-76185044 TTTCAAATATTTTTTATCTGTGG + Intergenic
1043189562 8:77201504-77201526 TTTTCTGTATTTTGTATTTGAGG + Intergenic
1043371492 8:79599172-79599194 TGTCTTAGATTTTGTTTCTCGGG - Intergenic
1044046631 8:87443377-87443399 TATCTTAGTTTTTCTATCTGTGG + Intronic
1044076901 8:87832851-87832873 TCTCCCAGTTTTTGTATCTACGG + Intergenic
1045396977 8:101771012-101771034 TTTCCTTGCTATTGTAGCTGTGG + Intronic
1045789285 8:105963030-105963052 TTTCCTAGACTTTGGATCCATGG + Intergenic
1046621888 8:116537148-116537170 TTTCATAGAGTTTGCATGTGAGG + Intergenic
1047298327 8:123590560-123590582 TTTCTCAGATTTTGTAGCTTTGG + Intergenic
1047795103 8:128247267-128247289 TCTGCTATATATTGTATCTGAGG + Intergenic
1048073847 8:131047297-131047319 TTTCATACATTTAGTATATGTGG - Intergenic
1048746202 8:137617101-137617123 TTTCCTAGATATGGAAACTGAGG + Intergenic
1048935670 8:139354555-139354577 CTTCCTATATTTTGTAGCTCTGG - Intergenic
1050620676 9:7449113-7449135 TTTCCTTCATTTTAAATCTGTGG - Intergenic
1051107907 9:13602038-13602060 TTTGCTAGATATACTATCTGTGG + Intergenic
1051352457 9:16210983-16211005 TTTTCTTTATTTTGTTTCTGTGG + Intronic
1051490957 9:17664295-17664317 ATTTCTGGATATTGTATCTGTGG - Intronic
1051834510 9:21320219-21320241 TTTCCTAGAGTTTCAATTTGAGG + Intergenic
1052192579 9:25677282-25677304 TTTCCTGTATTTTGGTTCTGAGG - Exonic
1052208715 9:25874672-25874694 TTTCCTAGCTATTTTATGTGTGG + Intergenic
1054166370 9:61734933-61734955 TTTTCAAGATTTTACATCTGAGG + Intergenic
1054320394 9:63654934-63654956 TTTCCTGAATTTTATATATGTGG - Intergenic
1055159172 9:73104083-73104105 TTTCATATATTCTGTTTCTGGGG + Intergenic
1055484920 9:76747467-76747489 TTTCCTTAATTTTGTAAGTGAGG + Intronic
1056975964 9:91254212-91254234 TTTCCCAGATTTTATAACTTGGG + Intronic
1056994281 9:91442202-91442224 TTTGCTAGATTTAGTATTTATGG + Intergenic
1057471872 9:95364920-95364942 TTTCCTAGAATCTTTATGTGGGG + Intergenic
1185990337 X:4888056-4888078 TTTCCTTGATTTTATATCATTGG + Intergenic
1189553394 X:42116026-42116048 TTTCTTAAATTTTGCACCTGAGG - Intergenic
1191727292 X:64294487-64294509 TTACCAAGATTCTGTCTCTGAGG + Intronic
1192108409 X:68339267-68339289 TTTCATAGATTTTCTTTATGAGG - Intronic
1192936732 X:75868188-75868210 ATTCTTAGATTTTGTCTTTGAGG + Intergenic
1193995314 X:88359775-88359797 TTTCTTAGATATGGTACCTGAGG + Intergenic
1194188042 X:90798091-90798113 TTTGCTTGATTTTGTCTCTTGGG - Intergenic
1194722192 X:97353563-97353585 ATTCCTATATTTGGTATATGAGG - Intronic
1194889280 X:99357257-99357279 TTGCCTAGATTTTCTATTAGGGG - Intergenic
1197456091 X:126677144-126677166 TTGCCTAGATTTTTCATCTAGGG - Intergenic
1197796833 X:130306766-130306788 TTTCCTTGATATTGTCTTTGAGG + Intergenic
1198523833 X:137479781-137479803 GTTCCTAAATTCTGTATCTCAGG + Intergenic
1200925654 Y:8652119-8652141 TTTCCTTGATCTTCTATATGCGG - Intergenic
1201126586 Y:10920586-10920608 TTTCCTAGGCTCTGTATATGGGG + Intergenic
1201428995 Y:13886772-13886794 TTTTTTAGATTTTTTATTTGAGG + Intergenic
1201686126 Y:16704487-16704509 TTTCCTTGATTTTATATCCCTGG - Intergenic
1202133490 Y:21635734-21635756 TCTACTAAAATTTGTATCTGTGG + Intergenic