ID: 1173228846

View in Genome Browser
Species Human (GRCh38)
Location 20:41178561-41178583
Sequence TTTCCTAGATTTTGTATCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 337}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173228846_1173228850 30 Left 1173228846 20:41178561-41178583 CCACAGATACAAAATCTAGGAAA 0: 1
1: 0
2: 2
3: 31
4: 337
Right 1173228850 20:41178614-41178636 TCCCCACAGGGGACCTCGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 127
1173228846_1173228848 18 Left 1173228846 20:41178561-41178583 CCACAGATACAAAATCTAGGAAA 0: 1
1: 0
2: 2
3: 31
4: 337
Right 1173228848 20:41178602-41178624 GAAATAGCAGCATCCCCACAGGG 0: 1
1: 0
2: 2
3: 11
4: 146
1173228846_1173228849 19 Left 1173228846 20:41178561-41178583 CCACAGATACAAAATCTAGGAAA 0: 1
1: 0
2: 2
3: 31
4: 337
Right 1173228849 20:41178603-41178625 AAATAGCAGCATCCCCACAGGGG 0: 1
1: 0
2: 0
3: 15
4: 189
1173228846_1173228847 17 Left 1173228846 20:41178561-41178583 CCACAGATACAAAATCTAGGAAA 0: 1
1: 0
2: 2
3: 31
4: 337
Right 1173228847 20:41178601-41178623 AGAAATAGCAGCATCCCCACAGG 0: 1
1: 0
2: 2
3: 13
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173228846 Original CRISPR TTTCCTAGATTTTGTATCTG TGG (reversed) Exonic