ID: 1173233802

View in Genome Browser
Species Human (GRCh38)
Location 20:41225347-41225369
Sequence TCAGTGGCCAGCCTCTGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173233802_1173233806 7 Left 1173233802 20:41225347-41225369 CCCACTCAGAGGCTGGCCACTGA No data
Right 1173233806 20:41225377-41225399 CAATTAACTGTAACAGCTAGAGG 0: 1
1: 0
2: 0
3: 11
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173233802 Original CRISPR TCAGTGGCCAGCCTCTGAGT GGG (reversed) Intronic
No off target data available for this crispr