ID: 1173235634

View in Genome Browser
Species Human (GRCh38)
Location 20:41243105-41243127
Sequence GTTCCCAGTGCTCCAAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 159}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173235629_1173235634 2 Left 1173235629 20:41243080-41243102 CCCAACCTTCAGGGTATGCTTCT 0: 1
1: 0
2: 4
3: 20
4: 176
Right 1173235634 20:41243105-41243127 GTTCCCAGTGCTCCAAGAGAGGG 0: 1
1: 0
2: 3
3: 11
4: 159
1173235624_1173235634 21 Left 1173235624 20:41243061-41243083 CCCAGGTCGGGGCAGACCTCCCA 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1173235634 20:41243105-41243127 GTTCCCAGTGCTCCAAGAGAGGG 0: 1
1: 0
2: 3
3: 11
4: 159
1173235632_1173235634 -3 Left 1173235632 20:41243085-41243107 CCTTCAGGGTATGCTTCTAGGTT 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1173235634 20:41243105-41243127 GTTCCCAGTGCTCCAAGAGAGGG 0: 1
1: 0
2: 3
3: 11
4: 159
1173235630_1173235634 1 Left 1173235630 20:41243081-41243103 CCAACCTTCAGGGTATGCTTCTA 0: 1
1: 0
2: 0
3: 11
4: 137
Right 1173235634 20:41243105-41243127 GTTCCCAGTGCTCCAAGAGAGGG 0: 1
1: 0
2: 3
3: 11
4: 159
1173235628_1173235634 5 Left 1173235628 20:41243077-41243099 CCTCCCAACCTTCAGGGTATGCT 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1173235634 20:41243105-41243127 GTTCCCAGTGCTCCAAGAGAGGG 0: 1
1: 0
2: 3
3: 11
4: 159
1173235625_1173235634 20 Left 1173235625 20:41243062-41243084 CCAGGTCGGGGCAGACCTCCCAA 0: 1
1: 0
2: 0
3: 5
4: 120
Right 1173235634 20:41243105-41243127 GTTCCCAGTGCTCCAAGAGAGGG 0: 1
1: 0
2: 3
3: 11
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173235634 Original CRISPR GTTCCCAGTGCTCCAAGAGA GGG Intronic
900674617 1:3877038-3877060 GTCCCCAGGGCTCCAGGAAAGGG - Intronic
900786325 1:4652989-4653011 GTTTGCAGGGCTCCATGAGAAGG - Intergenic
901962420 1:12838119-12838141 GTTCCATGTGCTCCTAGGGAAGG - Intergenic
902566632 1:17315771-17315793 TTTCCCAGGGCTACAAGGGAAGG - Intronic
903056226 1:20638043-20638065 GGTACCAGTGCACCAGGAGAAGG + Exonic
905241853 1:36586700-36586722 GTGTCCTGTGCTCTAAGAGAGGG - Intergenic
907304988 1:53508419-53508441 GTTTCCAGGGCTCCAACAAAGGG - Intronic
910821441 1:91353692-91353714 GTTTCCAGTGCTCTGAGACATGG + Intronic
913347588 1:117824116-117824138 GTTACAAAAGCTCCAAGAGAAGG - Intergenic
913596792 1:120386334-120386356 GTAGCCAGGGCTCCTAGAGAAGG + Intergenic
914090476 1:144492647-144492669 GTAGCCAGGGCTCCTAGAGAAGG - Intergenic
914308130 1:146441575-146441597 GTAGCCAGGGCTCCTAGAGAAGG + Intergenic
914593976 1:149131558-149131580 GTAGCCAGGGCTCCTAGAGAAGG - Intergenic
916879485 1:169005958-169005980 CTCCCCAGTGTTCCAAGACAAGG + Intergenic
1063243274 10:4192897-4192919 GGACCCAGTGCTCCTAGAGGAGG + Intergenic
1063578891 10:7287541-7287563 CTTCCCAGGGCACCAAGAGATGG + Intronic
1063821555 10:9842206-9842228 GTTTCCAGTTGTCCAAGTGAAGG - Intergenic
1064130200 10:12702648-12702670 GATCCCAGTTTTACAAGAGAAGG + Intronic
1065044711 10:21736958-21736980 GTGGCCAGTGAGCCAAGAGAAGG + Intronic
1065129933 10:22610270-22610292 GGTCCCAGGACTACAAGAGAAGG + Intronic
1065983985 10:30931021-30931043 TTTCCCAGTGCTCCAGTAGAGGG - Intronic
1068012476 10:51470802-51470824 GTTCATAGTGATCCAACAGAAGG + Intronic
1070779312 10:79128232-79128254 GTTTCCCCTGCTCTAAGAGAGGG + Intronic
1072768170 10:98113237-98113259 TTTCTCAGTGCTCAAAGAAAGGG - Intergenic
1074829173 10:117236647-117236669 GTTGCCAGTGCTCCAGGTGTAGG + Intergenic
1076679387 10:132163797-132163819 GTACCCAGGGGTCCAAAAGAGGG - Intronic
1079097075 11:17517877-17517899 GGTCCCAGAGCTCCAAGGCAAGG - Intronic
1081565256 11:44256823-44256845 GTTCCCAGTGCTCCATAGTATGG + Intergenic
1081668361 11:44929626-44929648 GTTCCGAGTCCTCAAAGACATGG - Exonic
1084484085 11:69437987-69438009 GGCCCCAGTGCAGCAAGAGAGGG - Intergenic
1089848854 11:121479983-121480005 GTCCCCAGGACTCCCAGAGAGGG + Intronic
1089971873 11:122700241-122700263 GTCCCCAGTGCTGAATGAGATGG + Intronic
1091322439 11:134661587-134661609 GATCCCAGTGCACCAAGACTGGG + Intergenic
1091538167 12:1433282-1433304 GTTGTAATTGCTCCAAGAGATGG + Intronic
1092329791 12:7574266-7574288 GTTGCCAGTGCTCCTAGTCAAGG - Intergenic
1097496408 12:60342718-60342740 TTTTCCAGGGCTCAAAGAGATGG + Intergenic
1101837422 12:108305094-108305116 GTTTCCCCTGCTACAAGAGATGG - Intronic
1102992770 12:117326956-117326978 GCTCCCAGTTCTGGAAGAGAGGG + Intronic
1103916475 12:124378378-124378400 CTTCCCTGTGCCCCAGGAGAAGG - Exonic
1104124438 12:125832780-125832802 CTTACCAGTGCCCCAAGATATGG - Intergenic
1105279241 13:18953673-18953695 GCTTCCAGTGCTCTAAGTGAAGG + Intergenic
1108642132 13:52392928-52392950 GTTACGGGTGTTCCAAGAGATGG + Intronic
1110064984 13:71092802-71092824 TTTCCCAGTCCTCCCAGAAATGG + Intergenic
1112578195 13:100655892-100655914 GTTGCAGGTGCTCCAAGACAGGG + Intronic
1112659273 13:101488825-101488847 GTTCCCAGTTCTCAAAAAAAAGG + Intronic
1113433349 13:110268997-110269019 GTTCTCCGTGCGCCAAGAGGTGG - Intronic
1116054570 14:39847553-39847575 TTTCCCAGTGCCTCAGGAGATGG - Intergenic
1116181688 14:41543399-41543421 CTTCCCAGTGCTCAGAGAGTGGG + Intergenic
1117206320 14:53447480-53447502 CTTCCCAGTGCTCTAGGACAAGG + Intergenic
1118733736 14:68687617-68687639 GTTCCCAGAGCAACCAGAGAAGG + Intronic
1119319514 14:73721377-73721399 GGTGCCAGAGATCCAAGAGAAGG - Exonic
1121887699 14:97559809-97559831 GCTTCCAGAGCCCCAAGAGAGGG + Intergenic
1122138770 14:99649916-99649938 GTTCCCAGTGAACCATGGGAGGG + Intronic
1122294585 14:100698101-100698123 GTGCCCAGTGCTCCAGTAGCCGG - Intergenic
1124983398 15:34583771-34583793 GGCCCCAGTGATCCAAGAGCGGG - Intronic
1125759658 15:42088044-42088066 ATTCCCAGAGCTCCCAGGGAGGG + Intronic
1130374031 15:83312214-83312236 GTGCCCAGTGCTCCAACAAAGGG + Intergenic
1131883039 15:96878743-96878765 GTTCACAGTGCTTAATGAGAAGG - Intergenic
1133110126 16:3543069-3543091 GTCCCCAGTGCTCCCAGCAAGGG + Intronic
1137378895 16:47979385-47979407 GTTCCCAGTATTGCAAGAGAAGG - Intergenic
1139325091 16:66146324-66146346 GTTCTCAGAGCACCAGGAGAAGG - Intergenic
1140194812 16:72847451-72847473 GCTCCCAGGGTACCAAGAGATGG - Intronic
1141471183 16:84239724-84239746 CTTCCCTGGGCACCAAGAGATGG - Intronic
1142001902 16:87669020-87669042 ATTCTCAGTGCTCCAAGGGCAGG - Intronic
1142132796 16:88438552-88438574 GTTCCCAGTGCACCCAAGGAAGG + Exonic
1147389801 17:40102149-40102171 AGTCCCAGTGCTTCTAGAGAGGG + Intergenic
1147888173 17:43698542-43698564 ATGCCCAGGGCTCCAAGACAGGG + Intergenic
1148908345 17:50926025-50926047 GTTGCCAGTGCTCCCTCAGATGG + Intergenic
1149328234 17:55555376-55555398 GTTCCCAGTGACACAAAAGATGG + Intergenic
1154970570 18:21404460-21404482 GTTTCTAGTGATACAAGAGAGGG + Intronic
1157308602 18:46535173-46535195 GTTCTCAGTGGTGAAAGAGATGG - Intronic
1157565334 18:48675710-48675732 GTTCCCAGGGGTCCCAGGGAGGG - Intronic
1163484494 19:17577834-17577856 GGTGCCAGTGCTACAAGAGGTGG + Intronic
1164917734 19:32065652-32065674 GTTCCCAGAGCCCCATGAGCGGG + Intergenic
1165698673 19:37920780-37920802 GTTCCCACTGCTGCCAGACACGG - Intronic
1166794889 19:45420134-45420156 GTGCCCAGTGCAACAAGAGCTGG - Intronic
1167768370 19:51499242-51499264 GTCCCCAGTCCTCAAAGTGATGG - Intronic
1168153679 19:54461947-54461969 GTGCTCAGTGCTCCAAGGAAAGG - Exonic
925605486 2:5655704-5655726 GTAGCCAGGGCTCCTAGAGAAGG + Intergenic
926038536 2:9654472-9654494 GGGCCCAGTTCTCCAGGAGAAGG + Intergenic
927022095 2:19028071-19028093 GTTCTCAGAGCCTCAAGAGAAGG - Intergenic
929043871 2:37772225-37772247 GTCCCCAGTGCTCCTAGGGTGGG + Intergenic
930252030 2:49044957-49044979 GTTTCTAGAGCACCAAGAGAGGG + Intronic
935494652 2:103765280-103765302 GTTCTCAATGCTCCAACGGAAGG - Intergenic
935609590 2:105007215-105007237 GTTCCAAGTTCTTCAAAAGAAGG + Intergenic
939025135 2:137003594-137003616 CTTCCCAGTGCTACAAGAGAAGG - Intronic
941732604 2:168934896-168934918 GTTCCAAGTGCCACAAAAGAGGG - Intronic
942145977 2:173026596-173026618 GTTCCCACTGTTCCAACAGTTGG - Exonic
947702527 2:232246419-232246441 GTTGCCAGTGCCCCGGGAGAGGG + Intronic
1171210478 20:23312836-23312858 GTTCCCAGGGCTTCACCAGATGG + Intergenic
1172047506 20:32090903-32090925 GCTCCCAGTGCTCCCAGTGGGGG - Intronic
1172568392 20:35949700-35949722 GTTTCCAGTGCTCCAACATAGGG - Exonic
1173235634 20:41243105-41243127 GTTCCCAGTGCTCCAAGAGAGGG + Intronic
1173384396 20:42574542-42574564 GTTACCATTGCTCCAGGGGATGG + Intronic
1174102677 20:48139155-48139177 GGTCCCAATGCCCCAGGAGAGGG + Intergenic
1175661535 20:60817100-60817122 GTTCCTGGTGCTCTGAGAGAGGG - Intergenic
1176044227 20:63084085-63084107 GTTCCCGGAGCCCCAACAGAGGG + Intergenic
1177287425 21:19070634-19070656 GTTCCAAGAGCAGCAAGAGAAGG + Intergenic
1179545002 21:42107864-42107886 GCCCCCATTGCTCCAGGAGAGGG + Intronic
1179908736 21:44437137-44437159 GGGCCCAGTGCTCGGAGAGAGGG - Exonic
1180069374 21:45428425-45428447 GTTTCCAGTCCTTCAAAAGATGG - Intronic
1181434027 22:22900049-22900071 GTTCCCAATTCCCCAGGAGATGG - Intergenic
1181434965 22:22905415-22905437 GTTCCCAATTCCCCAGGAGATGG - Intergenic
1181822784 22:25488467-25488489 GTGCCCAGAGCTCCAAGGAAAGG - Intergenic
1181858247 22:25798164-25798186 GTTCCCACCGCTCCGAGAGAAGG - Intronic
1183971226 22:41479045-41479067 GTTCACAGAGCTCTAAGACAAGG + Intronic
1183991247 22:41598423-41598445 TTTCCCAGAGCTCCATGGGAAGG - Exonic
1203296000 22_KI270736v1_random:43622-43644 GTCCCCAGTGCTCCTAGGGTGGG + Intergenic
949455357 3:4232431-4232453 GTCCCCTGTGAGCCAAGAGAAGG + Intronic
949693197 3:6664172-6664194 GGTTCCTGTGATCCAAGAGATGG + Intergenic
950235897 3:11319991-11320013 CTTCCCTGTGCTCTAAGAGTAGG + Intronic
952510095 3:34044303-34044325 TTTGCCAGTTCACCAAGAGAAGG - Intergenic
953387839 3:42516673-42516695 GTGCCCAGTGCTGTCAGAGAGGG + Intronic
955397662 3:58568814-58568836 TTTCCCAGTCCTCCAAGGGGAGG + Intronic
955521710 3:59781611-59781633 ATTCCCAGTGGTCCCAGAGATGG + Intronic
960820894 3:121730036-121730058 GTTGCCAGTGCACCAGGAAAAGG + Intronic
962927090 3:140004933-140004955 GGTCCCAGTGGACCAATAGAAGG - Intronic
962928803 3:140018985-140019007 CTTCCCATTGCTTCAAGAGAGGG + Intronic
970951811 4:21765354-21765376 GTACCCACTGCTCCAGGAGAAGG + Intronic
974973396 4:68859039-68859061 GTTCCCACTGATGCAAGGGATGG - Intergenic
976113329 4:81700250-81700272 GTTCCCTGTTCTCCAAAAGGGGG - Intronic
979090323 4:116475549-116475571 GTTGTCAGTACTGCAAGAGATGG + Intergenic
982506252 4:156220802-156220824 GTTCCACTTTCTCCAAGAGAAGG + Intergenic
983234102 4:165159525-165159547 TTACCCAGAACTCCAAGAGAGGG - Intronic
984602588 4:181745531-181745553 GTTCCCTGAGGTCCATGAGAGGG + Intergenic
986263923 5:6176351-6176373 GCTCCCTGTGCTACAAGACATGG - Intergenic
986347050 5:6845418-6845440 GTCCCCAGTGTTCCAGAAGAGGG - Intergenic
986605215 5:9516332-9516354 GTTCCCTGTTCTCCATGTGATGG - Intronic
987918404 5:24247170-24247192 TTTCCCAGTGGTCCAAAAGTAGG - Intergenic
992689462 5:79228804-79228826 GTGCCCATTGCTTTAAGAGATGG + Intronic
997437201 5:133884131-133884153 GCTCCCTCTGCTCCAGGAGAAGG + Intergenic
998450006 5:142226957-142226979 TTTCCAAGTGCTCCAAGGAAAGG - Intergenic
998928045 5:147148920-147148942 GCTCCCAGTGCCCCAAGGCAGGG - Intergenic
999248803 5:150169407-150169429 GTTCCCAAGGCTCCAGGAAAGGG + Intronic
1005862095 6:29909572-29909594 GTTCCCAGACCTACCAGAGAAGG - Intergenic
1006264037 6:32901644-32901666 GTTACCAGTGGTCCATGGGAAGG + Intergenic
1006449676 6:34098890-34098912 GTGCCCAGAGGTGCAAGAGATGG + Intronic
1015493426 6:133854686-133854708 GTTCCCAGGGCTAAAAGCGAGGG - Intergenic
1015726095 6:136301124-136301146 GTAGCAAGTGCTCGAAGAGAGGG - Intergenic
1017951950 6:159142435-159142457 GATCCCAGTGCTCCAATGCATGG - Intergenic
1020934721 7:14448202-14448224 GTTCCCAGTACTCATAGAGGAGG - Intronic
1021445920 7:20733553-20733575 TTTCCCAGTGCCCCAAGGGAAGG + Intronic
1024183376 7:46920697-46920719 GTTCCCAGGGCTAAAAGAGTGGG - Intergenic
1024192199 7:47024077-47024099 GTTGCCAGTGCTTCCAGAGGTGG - Intergenic
1024541593 7:50479555-50479577 GTTCTCAGTGCTTCTAGAGCAGG + Intronic
1025071940 7:55907255-55907277 ATCCCCAGTGCCCCAAAAGAAGG - Intronic
1027714092 7:81647524-81647546 GTTGCCAGTGCTCCAAGTTTTGG - Intergenic
1031535097 7:122923951-122923973 CTTACCATTGGTCCAAGAGAAGG + Intergenic
1032689972 7:134276100-134276122 TTTCCCAGTTCTCCCAAAGAGGG + Intergenic
1034090106 7:148355870-148355892 GTTCCCAGAGCTACAAAAAATGG - Intronic
1034837191 7:154363353-154363375 GTCCCCAGTGCTTCAAGAGAGGG + Intronic
1036628584 8:10494029-10494051 GTTCCCAGTAGTCCAAGAGATGG + Intergenic
1038959206 8:32499863-32499885 GCTTCCAGGGCTCCAAGAAAAGG + Intronic
1043989456 8:86734603-86734625 GTTCCCAGTGATTTAAGAAAGGG + Intronic
1045358322 8:101409396-101409418 GTTCTGATTGCTCCAGGAGAGGG - Intergenic
1056924327 9:90820078-90820100 GGTCCCATTGATGCAAGAGATGG + Intronic
1057208013 9:93184775-93184797 TTTCCCAGGGCCCCCAGAGACGG + Intergenic
1057545149 9:96014261-96014283 GTTCACAGGGCTGCAAGAGGAGG + Intronic
1057818182 9:98311151-98311173 TCTCACAGTGCTCCAGGAGAGGG + Exonic
1059411055 9:114132583-114132605 GTGCCCAGTCCCCCAAGACAAGG + Intergenic
1060270892 9:122140627-122140649 GTTCTCAGTGCTGCAAGAGTTGG - Intergenic
1061492941 9:130956320-130956342 GACCCCAGTGCCCCAAAAGAAGG + Intergenic
1185711571 X:2307956-2307978 TTTCCCAGGGCACCATGAGAGGG + Intronic
1185737353 X:2503638-2503660 GGTCCCAGTGTTGCAGGAGAGGG - Intergenic
1187063543 X:15811107-15811129 GTTCCCAGTTTTTCAAGAGGAGG - Intronic
1187354076 X:18550280-18550302 GTTCTCAGGTCTCCAAGACAAGG - Intronic
1187856626 X:23643100-23643122 CTTCCAAGGGCTGCAAGAGAAGG - Intergenic
1188941376 X:36241701-36241723 GTTCTCAGTGCTCTAAGACTGGG - Intronic
1191856057 X:65628002-65628024 GTTCACAATGATGCAAGAGATGG + Intronic
1194240165 X:91435559-91435581 CCTCCCAGTGCTCAGAGAGATGG + Exonic
1194888413 X:99348014-99348036 CTTCTCAGTGTTCCAAGTGAGGG + Intergenic
1194893337 X:99407102-99407124 GGTCACACTGCTGCAAGAGATGG - Intergenic
1198502703 X:137267889-137267911 CTGGCCAGTGCTCCAAGAGCAGG + Intergenic
1199933692 X:152550752-152550774 CTGCCCAGTGGTCCAGGAGATGG - Intergenic