ID: 1173236210

View in Genome Browser
Species Human (GRCh38)
Location 20:41247930-41247952
Sequence CTCTGTAAGAGCTTGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173236210_1173236217 17 Left 1173236210 20:41247930-41247952 CCCTGCTTCAAGCTCTTACAGAG 0: 1
1: 0
2: 0
3: 20
4: 164
Right 1173236217 20:41247970-41247992 TATAAATTCCTAACTGTTTCAGG 0: 1
1: 0
2: 1
3: 22
4: 261
1173236210_1173236218 20 Left 1173236210 20:41247930-41247952 CCCTGCTTCAAGCTCTTACAGAG 0: 1
1: 0
2: 0
3: 20
4: 164
Right 1173236218 20:41247973-41247995 AAATTCCTAACTGTTTCAGGTGG 0: 1
1: 0
2: 0
3: 16
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173236210 Original CRISPR CTCTGTAAGAGCTTGAAGCA GGG (reversed) Intronic
901746892 1:11379782-11379804 CTCTGCATCAGCTTCAAGCAAGG - Intergenic
903197758 1:21705258-21705280 CTCTGGAAGTACTTGAAGCATGG + Intronic
904096020 1:27977993-27978015 CTGTCTGAGAACTTGAAGCATGG + Intronic
904691815 1:32298696-32298718 CTCTTTAAGAGTTTAAAGTATGG + Intronic
907664554 1:56423362-56423384 CTCTGCAGGACCTTGAAACAGGG + Intergenic
910207442 1:84762256-84762278 CTCTGTCAGAGCTTGCAGGGGGG - Intergenic
910215376 1:84838735-84838757 ATCTGGAAGACTTTGAAGCAAGG - Intronic
910252232 1:85209877-85209899 CTACGCAAGAGGTTGAAGCAGGG - Intergenic
913084565 1:115424821-115424843 CTCTGTATTGGCTTGAAGAAGGG + Intergenic
918268803 1:182874652-182874674 CTCTCTTAGACCTTGAAGGAGGG - Intronic
918606593 1:186434600-186434622 CTCTGGAAATGCTTGAAGAAGGG + Intergenic
918884598 1:190175894-190175916 CTCTGCAGGATCTTGAATCATGG + Intronic
920908617 1:210193600-210193622 CTGTGTAAGAGCAGGAAGAAAGG - Intergenic
921568220 1:216746736-216746758 CTCTGTAAGAGCTTTAAGTTAGG - Intronic
922369060 1:224891538-224891560 CTGTGTAAGAGCAGGAAGAAAGG - Intergenic
924038089 1:239956276-239956298 CTCTGCATGAGCTGGCAGCAAGG + Intergenic
1064411486 10:15108478-15108500 CTCTGAAAGAGCCTGAGGCCGGG - Exonic
1067036033 10:42917838-42917860 TTCTGAAAGAGCCAGAAGCATGG - Intergenic
1068066304 10:52136421-52136443 CTCTTTTAAAGCATGAAGCAAGG + Intronic
1069813909 10:71181438-71181460 CTCTGGAAGAGTTTGCAGCCTGG + Intergenic
1073179076 10:101573319-101573341 CTCTGAGAGACCTTGAACCAGGG + Intronic
1074268319 10:111927668-111927690 CTCAGTAGGAGCTAGAACCATGG - Intergenic
1074504965 10:114061767-114061789 CTCTGTCAGAACTAGAAGAAAGG + Intergenic
1074548605 10:114422412-114422434 CCCTCAAAGAGCTTGAAGCCTGG - Intergenic
1075264886 10:120991608-120991630 CTCTGTAAGATTTTGATGCATGG + Intergenic
1079097973 11:17523093-17523115 CTCTGTCAGAGCTTCAGGGAAGG + Intronic
1082294244 11:50418693-50418715 CTCTCTTAGACCTTGAAGGAAGG - Intergenic
1083208935 11:61170631-61170653 CTCTTTAAGAGCAAGATGCAGGG + Intergenic
1085258219 11:75189227-75189249 CTCTGTAAGAGCTGGGCACACGG - Intronic
1086005350 11:82029671-82029693 CTGTGTAGGAGCTGGAAGAAAGG - Intergenic
1087126918 11:94637496-94637518 CCCTGGAACAGCTTAAAGCAGGG + Intergenic
1090821407 11:130345607-130345629 CCCAGTAAGAGCTGGAGGCATGG - Intergenic
1091173965 11:133543421-133543443 TTCTGGTAGAGCTTGGAGCAGGG + Intergenic
1091798949 12:3312657-3312679 TTCTGTAAGAGCTTGACTCCAGG + Intergenic
1092530545 12:9340892-9340914 GTTTGTAAGCTCTTGAAGCAGGG + Intergenic
1092631335 12:10381048-10381070 CTCTGTATAGGCTTGATGCAAGG - Intronic
1092862952 12:12735315-12735337 TGCTGTAAGAGTTTGAAACAGGG + Intronic
1095302861 12:40607100-40607122 CCCTGTAAGAGCCAGTAGCAAGG + Intergenic
1095977168 12:47947591-47947613 CTCTGCAGGGGCTTGCAGCAGGG + Intergenic
1099786020 12:87264947-87264969 CCCTGTAATATCTTGGAGCAGGG - Intergenic
1100000973 12:89834960-89834982 CTGTGGAAAAGCTTTAAGCAGGG - Intergenic
1101002789 12:100373403-100373425 GTCTGTAAGTGCTTCAAGCCAGG + Intronic
1102710998 12:114926641-114926663 TTATGAAAGACCTTGAAGCAGGG + Intergenic
1105401205 13:20097615-20097637 CTCTGTAATAGCTTATGGCAGGG - Intergenic
1105597697 13:21854905-21854927 CTCTGCAAAAGGTTGAAGGAAGG - Intergenic
1110412713 13:75221381-75221403 CTCTGTAAAAGAATAAAGCAGGG + Intergenic
1111077872 13:83262986-83263008 CCCAGTAAGAGCTTTAATCATGG + Intergenic
1111632653 13:90862385-90862407 CTTTTTAAGAGCTTGAAATAAGG - Intergenic
1117575268 14:57091419-57091441 CACTGTATGAGCATGGAGCATGG + Intergenic
1118137043 14:63041392-63041414 GTCTGTAAGCCCTTGAGGCAGGG + Intronic
1119691669 14:76677832-76677854 ATCTGTAAGAGCTTCTTGCATGG + Intergenic
1124814672 15:32977715-32977737 CTTCATAAGAGCTTAAAGCATGG + Intronic
1127999540 15:64177954-64177976 CATTGTCAGAGCTTGAAGGATGG - Intronic
1128063171 15:64748028-64748050 ATCTGTAAGAGCTTGATGAAAGG + Intronic
1129289230 15:74550798-74550820 CTCTGGAATAGATTGATGCATGG - Intronic
1131375394 15:91918884-91918906 CTCTGCAGGAGCTGGAACCAGGG - Intronic
1131483966 15:92805039-92805061 CTCTGGAATCGCTTGAACCAAGG + Intronic
1135945527 16:26861546-26861568 ATGTGCAAGACCTTGAAGCAAGG - Intergenic
1138711554 16:58976275-58976297 CCCTGTGCCAGCTTGAAGCAGGG - Intergenic
1139100003 16:63754123-63754145 CTCTGAAAGATTTTGAAGAATGG + Intergenic
1139200285 16:64968949-64968971 TTCTGTAATAGCTTTAAACATGG + Intronic
1139843876 16:69904915-69904937 CTATGTAAGAACTGGAAGTATGG - Intronic
1140894416 16:79312580-79312602 CACTGTAAGAGCTAGAAGGAAGG - Intergenic
1141771422 16:86092034-86092056 CTCTGGAAGGGCTTGCAGAATGG + Intergenic
1142038363 16:87876679-87876701 CTCAGTAACAGCTAGGAGCAAGG + Intergenic
1148436806 17:47691931-47691953 CTCTCTTAGAGCTTGCAGTATGG - Intergenic
1148511039 17:48170023-48170045 CTCACTAACAGCCTGAAGCATGG + Intronic
1149539602 17:57459023-57459045 CTTTGTAAGAGCTGGATGGATGG + Intronic
1150248977 17:63695722-63695744 CTCTGTAAGACCCTGAACCTGGG - Exonic
1152157270 17:78642594-78642616 CACTTTAAGAGGCTGAAGCAGGG + Intergenic
1152796401 17:82309735-82309757 AGCTTTAAGAGCTTGAAGTAGGG + Intergenic
1152927586 17:83094495-83094517 CTCTGGAAGTCCTTGAAGCGTGG - Exonic
1153250730 18:3119086-3119108 CTCTGTAAGAGTTACAAGCAAGG + Intronic
1155725316 18:29074151-29074173 CTCTTACAGAGCTTGAAGAATGG + Intergenic
1157365908 18:47064226-47064248 CACTTTAAGAGCATGAAGGAGGG + Intronic
1159277135 18:66235470-66235492 CTCTTTAGGATTTTGAAGCAAGG + Intergenic
1161746689 19:6064468-6064490 CTCTGAAAGATTTTGAAGCTGGG - Intronic
1163408380 19:17137666-17137688 CTCGGGCAGAGCTTGAAGCCCGG - Intronic
1163770711 19:19189435-19189457 CTATGGAAGAGTTTAAAGCAAGG - Intronic
1163780041 19:19241453-19241475 GTCTGGGAGGGCTTGAAGCAGGG - Intronic
1163817998 19:19478997-19479019 CTTTGTGAGGGTTTGAAGCATGG + Intronic
1167754208 19:51401273-51401295 CTGAGGAAGACCTTGAAGCATGG - Intergenic
1167978465 19:53252720-53252742 CTCTGCAAGATGTTGAAGAATGG - Intronic
925698258 2:6605989-6606011 CTTTGCAAGAGCTTGCAGCTTGG + Intergenic
927338199 2:21949947-21949969 CTACATAAGAGCTTGAAGAATGG - Intergenic
928362627 2:30678260-30678282 CTCTCTGAGAGCTAGAAGAATGG + Intergenic
929377993 2:41313790-41313812 TTCTGTAAAAGCAGGAAGCATGG + Intergenic
937869291 2:126776394-126776416 CTCAGTAAGAACATGAAGCCAGG + Intergenic
942401153 2:175604784-175604806 TACTGTAAGAGATTGCAGCAAGG - Intergenic
943513236 2:188852500-188852522 TTCTGTAATAGCTTGAAGATTGG - Intergenic
943693265 2:190891934-190891956 ATGGGTAAGAGCTGGAAGCATGG - Intronic
944971929 2:205003036-205003058 CTCTGCCAGAGCTTCTAGCAAGG - Intronic
948070008 2:235113594-235113616 CTCTGGAAGAGATTAAAGAAAGG - Intergenic
1169388361 20:5169839-5169861 GTGTGAAAGAGCTTGAAGCAAGG + Intronic
1169986580 20:11451920-11451942 TTCTTTAACAGCTTGAAGCCCGG + Intergenic
1170143648 20:13149737-13149759 CTCTGAAGGATCTGGAAGCAGGG + Intronic
1171782714 20:29435640-29435662 TTCTATAATAGCTTGAAGCGAGG + Intergenic
1173236210 20:41247930-41247952 CTCTGTAAGAGCTTGAAGCAGGG - Intronic
1173846342 20:46191137-46191159 AGCTGTGAGAGCTTGGAGCAGGG + Intronic
1179584139 21:42364421-42364443 CTGTGAAACAGCTTGAAGCAGGG + Intronic
1182667872 22:31972433-31972455 CTATGTTAGAGCTGGCAGCATGG + Intergenic
1182921848 22:34087621-34087643 CACTGGAATAGCTTGAACCAGGG - Intergenic
949923658 3:9023748-9023770 CTAAGTAGGAGCTTGGAGCAAGG + Intronic
950116297 3:10452320-10452342 CTCTGCACTAGCTTGTAGCAGGG - Intronic
951299794 3:20981777-20981799 CTGTGTAAGAGGTTGGAGCAGGG + Intergenic
951316745 3:21196526-21196548 GGCTGTAAGGACTTGAAGCAAGG - Intergenic
951784988 3:26407936-26407958 TTCTGTAAAATCTTGAGGCAGGG + Intergenic
952297482 3:32074068-32074090 CTGTGTAAGAGCAGGAAGAAAGG - Intronic
952958653 3:38576308-38576330 CTCTGTAAATCCTTGAGGCAGGG - Intronic
953000671 3:38930319-38930341 CTCAGAAAAAGCCTGAAGCAAGG - Intronic
955419217 3:58720107-58720129 TGCTTGAAGAGCTTGAAGCAGGG - Intronic
955947359 3:64208230-64208252 GTCTGTAAGAACTGGAAGCAAGG + Intronic
956020527 3:64928781-64928803 CTCTGTTAGAGCTTCCAGCATGG - Intergenic
957082765 3:75650693-75650715 TTCTATAATAGCTTGAAGCGAGG - Intergenic
959079124 3:101781020-101781042 CTGAGTAAGACCTTGAAACAGGG - Intronic
960407000 3:117273934-117273956 GTCTGTGAAAGCTGGAAGCAAGG - Intergenic
960872534 3:122264318-122264340 TTCTGTAGCAGCTTGAAGCTAGG + Intronic
961316612 3:126040537-126040559 CTCTGCAGGAGCTTCAAGGAGGG + Intronic
961871707 3:129993185-129993207 CTCCGCAAGAGCTTGGAGCAGGG - Intergenic
962181377 3:133209463-133209485 ATCTTTAAGAGCTTGCAGCATGG - Intronic
963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG + Exonic
963334339 3:143955781-143955803 GTGTGAAAGAGCTTGAAGAAGGG - Intergenic
968412433 4:401688-401710 CTGTGTAAGAGCAGGAAGAAAGG + Intergenic
968528572 4:1077764-1077786 CTCCATAAGAGCTTCCAGCAGGG + Intronic
969063015 4:4454127-4454149 CTTTGTAAGACATGGAAGCAAGG + Intronic
970819583 4:20197051-20197073 CTGTGTAAGAGCAGGAAGAAAGG - Intergenic
972417543 4:38857066-38857088 CTCTGTAAGAGTTTGCAGCCTGG + Intergenic
972818746 4:42675049-42675071 CTCTGTGAGTGGTTGAAGTATGG - Intergenic
976042264 4:80901136-80901158 CTCCCTAAGTGCATGAAGCAAGG + Intronic
983024960 4:162725547-162725569 CTATGTAAGAACTGGAAGCAAGG + Intergenic
985067453 4:186137014-186137036 CTCTCTAAGTGCTTAAAGCAGGG + Intronic
988789426 5:34593714-34593736 CTCTGTAAGAGATGGAACCTGGG + Intergenic
991501069 5:67278390-67278412 CTCAGTAGGAATTTGAAGCAAGG + Intergenic
991531000 5:67614005-67614027 ATCTGTAGGTGCTTTAAGCATGG + Intergenic
991601477 5:68355289-68355311 GTCTGTAGGAGCTTGGGGCAGGG - Intergenic
993148378 5:84126790-84126812 CTCTGTGAGTGCTTAATGCAAGG - Intronic
994042402 5:95273961-95273983 CTCAGTGAGAGCTTGCAGCTGGG - Intronic
996512171 5:124328899-124328921 CTATATAAGAGCTTGACACATGG - Intergenic
997157919 5:131578343-131578365 CTGTGTAAGAGCAGGAAGAAAGG - Intronic
1000978825 5:167794590-167794612 ATCTGGAAGAGTTTGAAGGAAGG + Intronic
1000981353 5:167820216-167820238 CTCTGAAAGAGGTTGAATCAGGG + Intronic
1002488849 5:179559639-179559661 CCCTCTAAGAGCTTGGGGCAGGG + Intronic
1005331355 6:24753578-24753600 CTATGTAGGAGCATCAAGCAAGG + Intergenic
1008217555 6:48813090-48813112 CTATGTAAGAACTAGAAGAAAGG - Intergenic
1010788149 6:80029707-80029729 CTTTGGAAGAGGTTGAAGCAGGG + Intronic
1012816366 6:104027266-104027288 CACAGTAAAAGCTTCAAGCAGGG + Intergenic
1013483210 6:110569727-110569749 CTCTGTTACAGACTGAAGCAGGG + Intergenic
1015223123 6:130827275-130827297 CTCTGAAAGAGCTTGGAAGATGG + Intergenic
1017549040 6:155484450-155484472 CTTTGTTAGAACTTGAAGGATGG + Intergenic
1021749657 7:23783221-23783243 GTCTGTAAGTGGTTGAAGTATGG + Intronic
1022667720 7:32427786-32427808 CTCTGTGAGATCCTTAAGCAAGG + Intergenic
1027601833 7:80248938-80248960 CTCTGCATGATCTTCAAGCAAGG + Intergenic
1032826553 7:135575370-135575392 CTGTGCAAGAGGGTGAAGCAAGG + Intronic
1033509023 7:142036062-142036084 CTCGGTAGGAGGTTTAAGCAAGG + Intronic
1033715786 7:144000696-144000718 CGCTGTAGGAGCCTGAAACAGGG - Intergenic
1035466769 7:159084515-159084537 CTCTGCAGGAGCCTGAAGCCTGG - Intronic
1035486773 7:159232303-159232325 CTCTGTAAGACCCTGCAGCGTGG + Intergenic
1036457112 8:8919406-8919428 AACTGAAAGAGCTTGCAGCATGG - Intergenic
1036494750 8:9260099-9260121 CTGTGAAAGGGCTTTAAGCAAGG - Intergenic
1037900883 8:22688757-22688779 CTCTGCCACAGCTTGCAGCATGG - Exonic
1042093795 8:65189464-65189486 CTTTGTAAGAGGTGGAAGAAAGG + Intergenic
1044170150 8:89041362-89041384 TTCTGAAAGAGATTGAACCAGGG + Intergenic
1046485128 8:114877384-114877406 CTCTGAAAGTGGATGAAGCAAGG + Intergenic
1052373957 9:27696704-27696726 CTCTGTAAGGGCATGTACCATGG - Intergenic
1054829259 9:69605337-69605359 CTGTATAAGAGCTTGAAACAAGG - Intronic
1055417355 9:76097956-76097978 ATCTGTTAGAGCCAGAAGCAGGG - Intronic
1055809416 9:80134714-80134736 CTCTGTAAGAGCTGAAAGTTAGG - Intergenic
1057708829 9:97418576-97418598 CTCTGAAACAGCTGCAAGCAGGG - Intronic
1058639063 9:107065418-107065440 CTATCAAAGAGCTTTAAGCAGGG + Intergenic
1060989512 9:127840234-127840256 CGCTGTATGACCTTGATGCAGGG - Intronic
1061788805 9:133047485-133047507 CACTATAAGAGTTTGAAGCAGGG + Intronic
1062445462 9:136592197-136592219 CACTGTCTGAGCTTGATGCAGGG - Intergenic
1186077063 X:5892096-5892118 CTTTGAAAGAGCTTTTAGCAAGG - Exonic
1186329525 X:8517529-8517551 GTCTGTAAGTGGTTGAAGTATGG + Intergenic
1186763314 X:12745762-12745784 CTGGGTAAGAGTTTTAAGCAGGG - Intergenic
1187217167 X:17288450-17288472 CTCTGTAGGACCTTCAAGCTTGG + Intergenic
1188524802 X:31076958-31076980 CTCTGTGATAGCTTTAATCATGG - Intergenic
1189194081 X:39137571-39137593 CTCTTTAAGTGCATGAACCAAGG + Intergenic
1189280949 X:39820047-39820069 CCCTGCAAGGGCTTGAAGTAGGG - Intergenic
1190841322 X:54147222-54147244 CACAGTAATCGCTTGAAGCAAGG + Intronic
1192165332 X:68824283-68824305 CCCTGTAAGAGCCTGAAATAGGG - Intergenic
1195005523 X:100681610-100681632 CTCTCAAAGATCTTCAAGCAAGG + Intronic
1196695601 X:118607784-118607806 CTCTGTATGTGTCTGAAGCATGG - Intronic
1197699593 X:129588798-129588820 CCCTGTAGGAGCTTGAGGAAAGG + Intronic
1198112741 X:133516028-133516050 CTTGGTAAGAGATTGAACCAAGG + Intergenic