ID: 1173238995

View in Genome Browser
Species Human (GRCh38)
Location 20:41276492-41276514
Sequence CCAATGTGGTAGTAGCTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173238992_1173238995 11 Left 1173238992 20:41276458-41276480 CCTCTCGGTCTCAAAACAACTGC 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1173238995 20:41276492-41276514 CCAATGTGGTAGTAGCTCTCTGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173238995 Original CRISPR CCAATGTGGTAGTAGCTCTC TGG Intronic
901248703 1:7755595-7755617 CTCATGTGCTAATAGCTCTCTGG + Intronic
906989712 1:50724831-50724853 CCATTGTGGTAGGTGCACTCTGG + Intronic
910765872 1:90781724-90781746 CCAATTTGGTGGGAGCACTCTGG - Intergenic
921745711 1:218738166-218738188 ACAATATAGTAGTAGGTCTCAGG + Intergenic
924417318 1:243870826-243870848 ACAATGTGTTACCAGCTCTCTGG - Intergenic
1067989218 10:51191223-51191245 CCAATGTGGTTCTGGTTCTCAGG - Intronic
1073998797 10:109346292-109346314 CCACTGGGGTGGAAGCTCTCTGG - Intergenic
1084711074 11:70844059-70844081 CCAAGGTGGTGGGAGCTCCCTGG + Intronic
1086840765 11:91681563-91681585 CCAATGTGGCAGGAAGTCTCAGG + Intergenic
1088382281 11:109206742-109206764 CTAATGTGGGAGTAATTCTCTGG - Intergenic
1098221829 12:68278310-68278332 CCACTGTGTGAGAAGCTCTCTGG - Intronic
1103043003 12:117711415-117711437 CCAATGTGGCTGAAGCTGTCTGG + Intronic
1105783289 13:23723050-23723072 TCCATGTGGTAGCAGCTCTTTGG + Intergenic
1105987674 13:25584657-25584679 CCAAACTGGTACTAGGTCTCAGG + Intronic
1107504223 13:41015254-41015276 CCAATATGGCAGTAGGTTTCGGG + Intronic
1117664159 14:58039003-58039025 CAAATGTGGTAGTGGCTCCAGGG - Intronic
1128638199 15:69316729-69316751 CCAAAGAGGTAGTTGCTCTGGGG + Intronic
1130059182 15:80557421-80557443 CCACTGGGGTAGTAGCCCACTGG + Intronic
1136346823 16:29681073-29681095 CCACTGTGGAACCAGCTCTCAGG + Intronic
1137999334 16:53258359-53258381 CAAATGTGATAGTTACTCTCTGG - Intronic
1138546855 16:57724828-57724850 CCATTGTGGTAAGAGCTCGCGGG + Exonic
1146248714 17:31316437-31316459 TCCTTGTGGTAGAAGCTCTCTGG + Intronic
1158288361 18:55910818-55910840 CCAAGGTGGTAACAGCTGTCAGG + Intergenic
927096586 2:19751791-19751813 CCAGTGTGGGAGTAGTTCTTTGG - Intergenic
927852940 2:26511183-26511205 CCAATGGGGTGGGAGCTCCCAGG + Intronic
928884641 2:36134486-36134508 GCAATGTTGTACCAGCTCTCTGG - Intergenic
935288634 2:101589546-101589568 ACAATGTGGTTGTAGCACTCTGG - Intergenic
937097864 2:119247515-119247537 CCAATGGGGTTCTAGCTCCCAGG - Intronic
941858404 2:170253635-170253657 TAAATGTGGGAGTAGCCCTCAGG - Intronic
946989046 2:225307481-225307503 GCAATTTGGTAGAAACTCTCAGG - Intergenic
1173238995 20:41276492-41276514 CCAATGTGGTAGTAGCTCTCTGG + Intronic
1175596870 20:60241800-60241822 CCCATGTTGTAGTAGGTATCAGG - Intergenic
1184851478 22:47123911-47123933 GCCATGTGGTATTAGCTCTTTGG + Intronic
1185079672 22:48702709-48702731 GCAATGTTGCAATAGCTCTCAGG - Intronic
949408952 3:3743147-3743169 CCAATATGGAAGTACTTCTCAGG - Intronic
950126119 3:10510814-10510836 CCAAGGAGGTATTAGCTCTGAGG - Intronic
950737655 3:15023303-15023325 CAAACGTGGGAGTAGCTATCAGG - Exonic
956713399 3:72057801-72057823 CCAATTTGGAAGTTTCTCTCAGG + Intergenic
959849401 3:111070630-111070652 CCAATGTGGCAGTGGCTCCAAGG + Intronic
959864338 3:111249019-111249041 TCAATGTTGAAGTAGCTCTCAGG + Intronic
981034814 4:140158409-140158431 TCAATGTGGTAATAACTCTTTGG - Intergenic
986939003 5:12927069-12927091 CCTATGTGATGGTAGCACTCAGG + Intergenic
998925225 5:147116046-147116068 CCAAACTGGAAGTAGCTCTGGGG - Intergenic
999734891 5:154505813-154505835 CCACTGTGGCAGTCTCTCTCTGG + Intergenic
1008578624 6:52885192-52885214 CCATTGTGGTAGTAGAGCTTGGG + Intronic
1012603515 6:101128706-101128728 TCAATGTGTTAGTATCTTTCAGG + Intergenic
1012723550 6:102780255-102780277 CGACTGTGGTTGTAGCTCTGAGG + Intergenic
1014412435 6:121142783-121142805 CCAATGGGGTAATAACTCCCGGG + Intronic
1015047319 6:128791083-128791105 AAAACGTAGTAGTAGCTCTCAGG + Intergenic
1022039360 7:26565495-26565517 CCCATCTGCTAGTTGCTCTCAGG - Intergenic
1022439672 7:30423197-30423219 GCCATGTGGTATTAGCTCTCTGG - Intergenic
1035658400 8:1328878-1328900 GAAATGTGGTAGAAGCTTTCAGG + Intergenic
1037291057 8:17349790-17349812 CCACTGTGGTAGTCACTCTCAGG - Intronic
1038061765 8:23922043-23922065 CTCCTGAGGTAGTAGCTCTCAGG + Intergenic
1047261722 8:123268265-123268287 GCCATTTGGTAGTAGCTTTCAGG - Intronic
1051649623 9:19308586-19308608 ACAATGTGGGAGAAGCTATCTGG - Intronic
1052135606 9:24906285-24906307 CCCATGTGGTAGTCTTTCTCTGG - Intergenic
1056720392 9:89066179-89066201 CTAATTTGGTAGTAGTTCTGGGG + Intronic
1058364146 9:104188084-104188106 CCAACCTGGTAGTAGCACTGTGG - Intergenic
1061973329 9:134056183-134056205 CCAATGTGGTTAAAGCTCTGGGG + Intronic
1203769708 EBV:43279-43301 CCAATGGGGTAGTAGGTTTTGGG + Intergenic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1196230375 X:113214734-113214756 CCAATATGGTAGTAGTTGTTTGG + Intergenic
1196925317 X:120628596-120628618 CTAATGTGGTAGAAGCACTATGG - Intronic
1201250894 Y:12056614-12056636 CCAATGTGGGTGGAGCCCTCTGG + Intergenic
1202202482 Y:22367592-22367614 GCACTGTGGGAGTACCTCTCTGG - Intronic